SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14943  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA000807
Annotation
PREDICTED:_AMP_deaminase_2-like_[Amyelois_transitella]
Full name
AMP deaminase      
Location in the cell
Mitochondrial   Reliability : 2.027
 

Sequence

CDS
ATGATGAAAGATGTCAAAAAATGCGAAGCGAACGATAATGCGGTCGCAGCGACGCGCACACATGTTCGAGGTCCCGGCGACAGCACGCGGCGCCGTGCCGACAACCAGGTCCCGTTCCAGAGAGTCTCCGTCGCCGGTATACATATCACTGGGGTGCCCATAGAGGAGTTGATACGTTCAGCCACTCTGCTGGTCGAAGCGTTGGGCTTGCGTCGCTACTACATGGAGGCCGCCCAGCAGTCCTTCCCGGAGACGCTGGTGGAGTTCTTCTCCGGGCACGGCTCCCCGCGGCGAATGCTCGACAAGCACAAGGAATCTATGGACTTTACTCGCGCTTTACTTAATTTGGACAGACTCGTGGACCCGTGGGCTTGTCCAAGCCCCCCAGATCGGCGGTACTCGTTCCGATGGGTGGACGGTGTGGTCGCGGTCTACCGCAGCGAGGGTGATGCGGCTTCGGGCAGGCCCTTACCTTACCGCACCGTCAAATTCAAGCAGTACGTCGACGATATGGGGAAGCTGAGTGACATGGTCGCTGATGGACCGCTGAAATCGTTTTGTTTTCGTCGTCTGAGCTACCTGAAGTCTAAGTTCAAGATGCACGTACTGCTGAATGAGCTTCACGAGCTGGCTTTACAGAAAGCTGTTCCGCATCGAGACTTCTACAACATCAGAAAAGTGGATACTCACATTCACGCTGCGTCGTGCATGAACCAGAAACATTTGTTGCGGTTCATCAAGCGTACCCTGCGGCAGAACGCCCACGAGGTGGTGGCCTTGCAACGCGGGGTCCCGATGACCCTCAAATCTGTGTTTGAGGAGATGCAGCTCGACGCCTACGACCTCAACGTTGACATACTGGACGTTCACGCGGACCGCAACACTTTCCATCGTTTTGATAAGTTCAATGCCAAATACAATCCGGTCGGAGAGAGCCGACTGAGGGAAGTGTTCTTGAAGACCGACAACTACATGAACGGAACGTATTTCGCCAACATCATTAAGGAAGTGATGTCGGATTTCGCAGAGAATAAGTACACGTACTCCGAGCCCCGCATCTCGGTGTACTGCAAGAGCAGCAGCGAGTGGAGTCGGCTGGCGTCGTGGGCGGTCCGGAACGACGTGCACTCGCCCCACGTGAGGTGGCTCGTGCAGGTCCCCAGGCTCTATGATATCTACCGCATCAACAAGTTGCTGAAGAATTTCCAGCAGTTTCTGAGCAACCTTTTTGATCCGTTGTTTGAAGTTTCCATCGACCCCAGTTCCAATCCGGAGCTGCACAAATTCTTGGCGCACGTGATCGGGTTCGATAGCGTGGACGATGAGTCCAAGCCGGAGATCCCGAACCTCAGCGAACATATGAGAACTCCCGAGGAATGGAACGACGAGGAGAACCCTCCGTACGCGTACTACCTGTACTACATGTACGCTAACATGGTCACCCTCAATGAGTTGCGCAAGGAGCAGGGGCTGAACACATTCGTGCTGCGCCCCCACTGCGGGGAGGCCGGGCCCGCCGCGCACCTGAGCGCCGGATTCCTCCTCGCCGAGAACATATCTCACGGACTCATCCTGAGAAAGGTGCCCGTGCTCCAGTACGCGTACTACTTGGCCCAGATCTACATCGCGATGTCTCCGCTCAGCAACAACTCGCTGTTCCTCAACTACCATAGGAACCCGCTGCCAGAGTACTTCGCGAGAGGACTCCGGGTCACTCTGAGCACTGATGATCCTCTGCAGTTCCATTTTACTAGGGAGCCGCTGATGGAGGAGTACAGTATAGCCGCGCAGGCGTGGAAGCTCAGCTCGTGCGACATGTGCGAGCTGGCCAGAAACTCTGTGCTCATGTCCGGGTTCCCGCACGAGATGAAGCAGTACTGGCTGGGCGCGCAGTACGTGCACGAGGGTCCGGCCGGGAACGACATCACCAAGACCAACGTCCCCGACGTCAGGATCTCGTTCCGCCACGAGACCTTACTCGACGAGCTGGACAACTTGTTTAGCGCAGCCGAAAAATAA
Protein
MMKDVKKCEANDNAVAATRTHVRGPGDSTRRRADNQVPFQRVSVAGIHITGVPIEELIRSATLLVEALGLRRYYMEAAQQSFPETLVEFFSGHGSPRRMLDKHKESMDFTRALLNLDRLVDPWACPSPPDRRYSFRWVDGVVAVYRSEGDAASGRPLPYRTVKFKQYVDDMGKLSDMVADGPLKSFCFRRLSYLKSKFKMHVLLNELHELALQKAVPHRDFYNIRKVDTHIHAASCMNQKHLLRFIKRTLRQNAHEVVALQRGVPMTLKSVFEEMQLDAYDLNVDILDVHADRNTFHRFDKFNAKYNPVGESRLREVFLKTDNYMNGTYFANIIKEVMSDFAENKYTYSEPRISVYCKSSSEWSRLASWAVRNDVHSPHVRWLVQVPRLYDIYRINKLLKNFQQFLSNLFDPLFEVSIDPSSNPELHKFLAHVIGFDSVDDESKPEIPNLSEHMRTPEEWNDEENPPYAYYLYYMYANMVTLNELRKEQGLNTFVLRPHCGEAGPAAHLSAGFLLAENISHGLILRKVPVLQYAYYLAQIYIAMSPLSNNSLFLNYHRNPLPEYFARGLRVTLSTDDPLQFHFTREPLMEEYSIAAQAWKLSSCDMCELARNSVLMSGFPHEMKQYWLGAQYVHEGPAGNDITKTNVPDVRISFRHETLLDELDNLFSAAEK

Summary

Catalytic Activity
AMP + H(+) + H2O = IMP + NH4(+)
Cofactor
Zn(2+)
Similarity
Belongs to the metallo-dependent hydrolases superfamily. Adenosine and AMP deaminases family.
EC Number
3.5.4.6
EMBL
BABH01034221    AGBW02011505    OWR46546.1    KZ149945    PZC76812.1    NWSH01002867    + More
PCG67416.1    ODYU01008185    SOQ51571.1    KQ460205    KPJ17035.1    KQ459604    KPI92113.1    KPI92114.1    SOQ51570.1    BABH01034219    BABH01034220    OWR46545.1    PZC76811.1    PCG67412.1    PCG67415.1    PCG67413.1    GL445285    EFN89896.1    KK107054    EZA61572.1    RSAL01000004    RVE54548.1    GL434395    EFN74955.1    KQ982625    KYQ53483.1    KQ976731    KYM76219.1    KQ981523    KYN40367.1    GEZM01088534    JAV58128.1    GEZM01088536    JAV58126.1    GL887707    EGI70281.1    GEZM01088537    JAV58125.1    GEZM01088535    JAV58127.1    GEZM01088538    JAV58124.1    KQ980724    KYN14036.1    KQ414740    KOC62055.1    GFDF01002812    JAV11272.1    AK417940    BAN21155.1    KZ288387    PBC26413.1    GEBQ01017682    JAT22295.1    GEBQ01011984    JAT27993.1    GEBQ01013760    JAT26217.1    AXCN02001394    APCN01001124    GBHO01041840    GBHO01041838    GBRD01002547    GDHC01012526    JAG01764.1    JAG01766.1    JAG63274.1    JAQ06103.1    GFDF01002825    JAV11259.1    GFDF01002813    JAV11271.1    GBRD01002546    JAG63275.1    NEVH01010578    PNF32244.1    GBHO01041839    GBHO01041837    JAG01765.1    JAG01767.1    GBHO01041842    GBHO01041841    GBRD01002545    JAG01762.1    JAG01763.1    JAG63276.1    AAAB01008846    EAA45063.5    GGFL01005355    MBW69533.1    GAIX01005062    JAA87498.1    GDUN01000039    JAN95880.1    PNF32246.1    ADTU01006991    ADTU01006992    GFDL01000477    JAV34568.1    ATLV01003052    KE524109    KFB34904.1    AXCP01007583    EGK96409.1    GGFL01005380    MBW69558.1    CH902635    KPU74815.1    GGFK01000352    MBW33673.1    AXCM01001247    GFDL01000460    JAV34585.1    GGFK01000353    MBW33674.1    EGK96407.1    EGK96408.1    JXUM01107648    KQ565160    KXJ71273.1    KQ435031    KZC14014.1    GAMD01001576    JAB00015.1    KPU74818.1    GGFJ01002235    MBW51376.1    GGFJ01002303    MBW51444.1    GGFJ01002244    MBW51385.1    ADMH02000938    ETN64625.1    KPU74817.1    GGFM01006672    MBW27423.1    GGFJ01002458    MBW51599.1    EDV33875.1    KA649555    AFP64184.1    KA646562    AFP61191.1    GDAI01000239    JAI17364.1    KK852478    KDR22976.1    KPU74819.1   
Pfam
PF00962   A_deaminase
Interpro
IPR032466   Metal_Hydrolase        + More
IPR006329   AMPD       
IPR001365   A/AMP_deaminase_dom       
IPR006650   A/AMP_deam_AS       
IPR029749   AMPD2       
SUPFAM
SSF51556   SSF51556       
PDB
2A3L     E-value=3.45642e-160,     Score=1452

Ontologies

Topology

Length:
672
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.51332
Exp number, first 60 AAs:
0.09296
Total prob of N-in:
0.00686
outside
1  -  672
 
 

Population Genetic Test Statistics

Pi
252.817454
Theta
177.590628
Tajima's D
1.468938
CLR
0.340494
CSRT
0.777111144442778
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
26822097 ISSCDMCEIAR 100.00 1e-04
25044914 KVDIEVISAISGIGATVHK 100.00 1e-04
28467696 KVDNIDVIAIQGQYEYSAPDGTPVK 100.00 1e-04
28556443 WLIQIPR 100.00 0.015
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号