SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14942  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA000806
Annotation
PREDICTED:_AMP_deaminase_2_isoform_X3_[Bombyx_mori]
Full name
AMP deaminase      
Location in the cell
Cytoplasmic   Reliability : 1.496 Nuclear   Reliability : 2.109
 

Sequence

CDS
ATGTCCATCAGGGGTGTCCAGGACGGCTCCAGATCACCGTTGATCATCACCGATTCGTTCTTCGATGATGGCGGCAGTGAAAGTCCGACGAGCGCCGTGGGGGCGGAGGCGCCGCGGGAGCTCCCTAATGAACTCTCCGCGCCTTATGAAGTCCCGCAGTTTCCAATCGAACAAATCGAGAAGAAACTACTCATACAGAGGCAGCTGAATGTTAAGGCGGCGGAATGCGCTCAGTCTGTGCGTTCATTCGCGGGCAGCGAAGCAGGCGCGGCAGCCGTGTTTGAAGAGGCGGCTCGGCTCAGGGTCCCCGATGATGACGATGACGAGATCATCTTGCCGCACTTCCAGCGTGTCGCTATCAGCGGCGAGGATACTTCCGGGGTACCACTGGAAGATCTTCAACAAGCGTCCTCGTACCTGGTGCAGGCTCTGGAAATGCGCAAGCGTTACATGGAGATGTCCCAGCAGAGCTTCTCGCCCATTACGGCGCGCTTCATCAGGAGCATGGACGCGGATGCCGTAGCCAACCACGTACCCGTTAAAGTACCCAACAAACATATTGCGGACCATATAGTCCACCCTCCATTCAGAGACAAGGATCCGTGGGAATGTCCTATGCCGGAGCCCAAGGGCTACAGCATACGACTAAACAGGGGCGTGTTCAACATGTACCGCCAAGGACCGAACGGAGAGGAGCGACTGCCCTACGAATACATCACACTGGCGCAATACATCCAGGACATGAATACAATGTGCAACATGATCGCCGATGGTCCTCTAAAGTCCTTTTGCTACCGTCGCCTCAGCTACCTATCGTCCAAGTTCCAGCTCCACGTTCTGCTGAACGAGCTCAGGGAACTAGCTTCCCAGAAGGCAGTTCCTCATAGAGACTTCTACAATATCAGGAAGGTGGATACGCACATCCACGCGGCGTCTTGCATGAACCAGAAACACTTACTGCGGTTCATTAAGAAGACATTGAAGACGCATGCGGACGAGGTGGTGACCCTCCACAAAGGCACACCTATGACCCTGAGGTCTGTGTTCCAATCCATGAACCTGAGCACCTACGACCTCACCGTGGATATGCTGGACGTGCACGCGGACCGGAACACGTTCCATCGCTTCGACAAGTTCAACGCGAAGTACAACCCAATCGGGGAGAGCAGACTCCGCGAGGTGTTCCTCAAGACCGACAACTACATGAACGGAAAGTACTTCGCCAGGATCATTAAGGAGGTGGCGTCGGACCTGGAGGAGAGCAAGTACCAGAACGCGGAGCTGCGGCTGTCGGTGTACGGCAAGAGTCCCGGCGAGTGGGCCAAGCTCGCCAAGTGGGCCATCCAGTACGACGTGCACTCCAACAACGTGCGCTGGCTCATACAGATACCCCGCCTCTACGACATCTTCAAATCCAACAAAATAATGAACGACTTCCACGAGTTCTTGAACAACATCTTCCAGCCTCTCTTCGAAGTCACAAACGATCCTAACAGCAACATCGAGCTGCACAAGTTCCTCACACACGTGATCGGGTTCGACAGCGTGGACGACGAGTCCAAGCCCGAGAACCCGATGCTGGACACCGAAGTCAAAAGCCCCGAAGAGTGGGACGACGAGGAGAACCCTCCGTACGCGTACTACCTCTACTACATGTACGCCAACATGACTGTACTGAACCATTTCCGCAAGGAGCAAGGTCTGAACACGTTCGTCCTGCGTCCTCACTGCGGAGAGGCGGGTCCTGTACAGCATCTCGTCTGCGGCCTCCTGCTCGCCGAGAACATCTCCCACGGCCTCCTACTCAGGAAGGTACCAGTCCTGCAGTACCTGTACTACCTCGCCCAGATCTACATCGCGATGTCTCCGCTCAGCAACAACTCGCTGTTCCTCAACTACCACAGGAACCCGCTGCCGGAGTTCTTAGCTCGAGGGCTCTGCATCACTCTCAGTACTGACGACCCCCTGCAGTTTCACTTCACCAAGGAGCCGCTGATGGAAGAATACAGTATCGCAGCGCAAGTGTGGAAGCTCAGTTCATGCGACATGTGTGAATTGGCAAGGAATTCGGTGCTCATGTCCGGATTCCCGCACGAGATGAAGCAGTACTGGTTAGGGCCCAACTATACCAAGGAAGGTGTGGCCGGTAATGACATAACTCGAACCAACGTACCCGATATCCGCATTTCGTTCCGTCACGAGACCATCCTCGATGAGCTGACCAACATATTCAAGGATGGTATGTCTACTCAGAGATAA
Protein
MSIRGVQDGSRSPLIITDSFFDDGGSESPTSAVGAEAPRELPNELSAPYEVPQFPIEQIEKKLLIQRQLNVKAAECAQSVRSFAGSEAGAAAVFEEAARLRVPDDDDDEIILPHFQRVAISGEDTSGVPLEDLQQASSYLVQALEMRKRYMEMSQQSFSPITARFIRSMDADAVANHVPVKVPNKHIADHIVHPPFRDKDPWECPMPEPKGYSIRLNRGVFNMYRQGPNGEERLPYEYITLAQYIQDMNTMCNMIADGPLKSFCYRRLSYLSSKFQLHVLLNELRELASQKAVPHRDFYNIRKVDTHIHAASCMNQKHLLRFIKKTLKTHADEVVTLHKGTPMTLRSVFQSMNLSTYDLTVDMLDVHADRNTFHRFDKFNAKYNPIGESRLREVFLKTDNYMNGKYFARIIKEVASDLEESKYQNAELRLSVYGKSPGEWAKLAKWAIQYDVHSNNVRWLIQIPRLYDIFKSNKIMNDFHEFLNNIFQPLFEVTNDPNSNIELHKFLTHVIGFDSVDDESKPENPMLDTEVKSPEEWDDEENPPYAYYLYYMYANMTVLNHFRKEQGLNTFVLRPHCGEAGPVQHLVCGLLLAENISHGLLLRKVPVLQYLYYLAQIYIAMSPLSNNSLFLNYHRNPLPEFLARGLCITLSTDDPLQFHFTKEPLMEEYSIAAQVWKLSSCDMCELARNSVLMSGFPHEMKQYWLGPNYTKEGVAGNDITRTNVPDIRISFRHETILDELTNIFKDGMSTQR

Summary

Catalytic Activity
AMP + H(+) + H2O = IMP + NH4(+)
Cofactor
Zn(2+)
Similarity
Belongs to the metallo-dependent hydrolases superfamily. Adenosine and AMP deaminases family.
EC Number
3.5.4.6
EMBL
BABH01034219    BABH01034220    BABH01034221    KQ459604    KPI92114.1    ODYU01008185    + More
SOQ51570.1    NWSH01002867    PCG67412.1    PCG67415.1    PCG67413.1    KZ149945    PZC76811.1    AGBW02011505    OWR46545.1    GAIX01005062    JAA87498.1    KK107054    EZA61572.1    GL887707    EGI70281.1    KQ976731    KYM76219.1    GL445285    EFN89896.1    KQ981523    KYN40367.1    KQ982625    KYQ53483.1    KQ980724    KYN14036.1    GL434395    EFN74955.1    GEBQ01013760    JAT26217.1    QOIP01000004    RLU23286.1    GEBQ01017682    JAT22295.1    GEBQ01011984    JAT27993.1    NEVH01010578    PNF32244.1    GBHO01041839    GBHO01041837    JAG01765.1    JAG01767.1    GBHO01041842    GBHO01041841    GBRD01002545    JAG01762.1    JAG01763.1    JAG63276.1    GEBQ01018364    JAT21613.1    GBHO01041840    GBHO01041838    GBRD01002547    GDHC01012526    JAG01764.1    JAG01766.1    JAG63274.1    JAQ06103.1    GBRD01002546    JAG63275.1    GEDC01017104    JAS20194.1    GDUN01000039    JAN95880.1    GEBQ01003190    JAT36787.1    GAKP01020136    JAC38816.1    KK852478    KDR22976.1    GEBQ01030929    JAT09048.1    GDAI01000239    JAI17364.1    GFDL01000460    JAV34585.1    GANO01003241    JAB56630.1    APCN01001124    GEDC01011577    JAS25721.1    AAAB01008846    EAA45063.5    GAKP01020134    GAKP01020133    GAKP01020132    JAC38819.1    GEDC01010431    JAS26867.1    GFDF01002813    JAV11271.1    GAKP01020135    JAC38817.1    ADTU01006991    ADTU01006992    GGFK01000352    MBW33673.1    EGK96409.1    AXCP01007583    GGFK01000353    MBW33674.1    GAMC01014659    JAB91896.1    GDHF01014436    JAI37878.1    GFDL01000477    JAV34568.1    AXCM01001247    GAKP01020131    JAC38821.1    GEDC01015341    JAS21957.1    KA646562    AFP61191.1    GAKP01020130    JAC38822.1    PNF32245.1    GGFL01005380    MBW69558.1    GGFL01005355    MBW69533.1    UFQT01001348    SSX30145.1    KA649555    AFP64184.1    GAMD01001576    JAB00015.1    GGFJ01002303    MBW51444.1    GBXI01007228    GBXI01006890    JAD07064.1    JAD07402.1    SSX30146.1    GGFJ01002458    MBW51599.1    GAMC01014658    JAB91897.1    GDHF01029308    JAI23006.1    GGFJ01002235    MBW51376.1    GGFJ01002244    MBW51385.1    ADMH02000938    ETN64625.1    GGFM01006672    MBW27423.1    AXCN02001394    GBXI01010322    JAD03970.1    GEZM01088536    JAV58126.1    GEZM01088534    JAV58128.1    KQ414740    KOC62055.1    GFDF01002825    JAV11259.1    GEDC01015054    JAS22244.1    GEDC01000238    JAS37060.1    GFDF01002812    JAV11272.1   
Pfam
PF00962   A_deaminase
Interpro
IPR032466   Metal_Hydrolase        + More
IPR001365   A/AMP_deaminase_dom       
IPR006329   AMPD       
IPR006650   A/AMP_deam_AS       
IPR029749   AMPD2       
SUPFAM
SSF51556   SSF51556       
PDB
2A3L     E-value=2.1306e-160,     Score=1454

Ontologies

Topology

Length:
752
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.763419999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00018
outside
1  -  752
 
 

Population Genetic Test Statistics

Pi
239.543872
Theta
178.515514
Tajima's D
1.480591
CLR
0.261915
CSRT
0.782960851957402
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
26822097 ISSCDMCEIAR 100.00 2e-04
25044914 KVDIEVISAISGIGATVHK 100.00 2e-04
28467696 KVDNIDVIAIQGQYEYSAPDGTPVK 100.00 2e-04
26822097 NPIPEFIAR 100.00 5e-04
26280517 DIYANTVISGDTTMYPGIADR 100.00 5e-04
26822097 IQFIVR 100.00 0.001
26280517 YISTSEDINNR 100.00 0.001
25044914 YMDTFK 100.00 0.001
27102218 EMIIEVNPEK 100.00 0.001
28467696 YMDTPQANPIGYER 100.00 0.001
25044914 WAIISIR 100.00 0.002
25044914 SKYWEYVYEDTMNIIAK 100.00 0.009
28556443 WLIQIPR 100.00 0.018
26280517 HHYAIFVR 100.00 0.023
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号