SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14940
Pre Gene Modal
BGIBMGA006890
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like_isoform_X1_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 3.765
 

Sequence

CDS
ATGGCAACAAATAACAACGAAGCAGTCTCCGGTATTAAACCACCCGGATACTTGCACATCGAGTCGGACAACAAGTCGGCAAATTGGAAAAAATGGCGACAACAGTTCGAATGGTATGCAACAGCAATTCAGCTAGGAAAGAAACCTGCCGATATTCAAGCTGCAACATTCATGTCAATCATAGGACCAGATGCAATTGACATCTACAACAGTTTTAATTTGAATACAATAGACGAACAAAAATTAAGCATCATTATCGGAAAGTTCGAAGAATATTTCGCGCCGAAAAACAACATATCGTTCGAAAGGTATGTTTTCTTCAAAATTGAACAACATGAAGACGAATCGTTTAACGAATTCATCACTAGAATTAAAACACAAGCAAACAAATGCGAGTTTGGCACTCTACTTGAAGAAATGCTAAAAGACAAGATTGTATTCGGAATAAAATCAACCCAAATCAGAGAAAAATTACTCACCGAAGAAAAACTTGATCTCACAAAAGCCACAGCCATCTGTAAAAGCAGTGAACAAGCTTCCAAACAACTTAACGAGTTTGAGAATAACAACAAGAGTGAAAAAATACTGACAATCAAAAGTAAGAACTTCAGAAATGAAAAATTTGACTGTAAAAGATGTGGTTCAAGCCACAAGGCTAGAGAATGCCAAGCCTACAACAAATTATGCACAAAGTGTAACAAGGCCGGTCATTTTGCAAAAATGTGTCGTTCCCAAATCCAATTGAAACAAAAAAATAAAATAAATACTCTAGAAGAAAATTCTACTTCCGAAAATTCAGATGAATCATTTATAGGACAATTAAGTGTCGGCAACTCCAAAGATTGGACAGAAAGTGTCGAAACTGCCAACACCAAATTCACAGCAAAGCTTGATACTGGTGCAGAGTGCAACGTCCTTCCAAATTTCATAGTACAGAAAACTCATGCTTGTATACAACCAAGTCGCACTAAAAATTTAATAAGTTATTCAAATAACAGAATTTCAGTACTTGGAGAAGTAAAGTTACAATGCAAAATAAAAAAGAAAACTGCTAAAATACTATTTAAAGTTGTAGCTGAAAGAGTCACACCAGTCTTAGGACTAAACACTTGTGAGAAGCTGGGACTAATTGCACGAGTTGAAACATTGAAAGAAAGCTCATCCAATGATGACATATTTAAAGGGTTAGGTTGCTACAAAAATTTTGAGTATGATATTGACCTCATAGAAAACCCCAAATTTGAAATAAAACCAACAAGAAAAGTTCCACATGCCATAAGAAATGAAGTAAAACAAGAATTAGATAGAATGGTAAAATTGGATGTCATCACACCTGAAACAGAACCGACACCAGCAGTAAGTCCGATGGTCGTAGTCAGACAAAAAGGAAAATTGAGAATATGCATCGACCCATCGGATGTGAACAAAAATATTTTAAGAAGACATTTCCCACTTGCAACAATAGAAGAGATAGCAGCAGACATCAAAGGATCAGAATACTTTTCCCTACTAGACTGCACCAAAGGATTTTGGCAAATTAAATTATCAAAAAGAACACAAAAGATACTGACATTTTCTACACCATGGGGAAGATATTCATTCAAAAGACTTCCATTCGGACTATCGTCAGCCCCTGAAATTTTTCAAGAAATCTTGACTAATCTTCTCAGCAAATTCAAAAATGTAAAAGTATCAATCGATGATATCTTTATTCATGCCAAAAAGAAGGAAGAGCTACAGAAAACGGTCAAAGAAGTAATAGAGACATTGAAAATTTCTGGCTTCAAACTCAATCAAAGCAAATGCATCTTTGAAGCCAAAAGAATAAAATTTTTGGGTCATATAGTCTCAGCCAAAGGTTTAGAAGCAGATCCTGAAAAAGTCAAAGCCATAGAATTTATGAAAACACCACAGAACAAAAAAGAACTGCAAAGGATACTAGGAATGATAACATATTTAAATAAATACATACCCAACATGTCAGAATTAACAAACCCTTTGAGAGACCTACTTCACAAGGACACAAGTTTCAACTGGGAATTCTATCATGATGAAGCACTCAACAAAATTAAAAAAGTTTTACAGAATCCGCCAGTGCTAAAACTATATGATGTAAACAAACCAGTCACACTAAGCGTGGATGCAAGCTCAAAGAATCTCGGTGCAGCACTTCTTCAGGAAGGCCAACCAGTAGCTTATGGAGCCAGAACGTTGACTAAATCCGAACAAAATTATCCTCAAATTGAAAAGGAAGCACTTGCTATACTATTTGGGTGCAAAAAGTTCCATGAGTATGTCTATGGCAAAGAGTTATTAGTCGAATCAGATCACAAGCCGCTCGAGACAATATTCAGAAAAAACATTCAGTCAGCCCCAGCTAGATTTCAACGTATAATGCTCAACCTAACACCGTATTCACCAAAAATTACATTTAAAAAAGGCACAGAAATACCACTAGCAGACTTTTTAAGTCGTGATTGTGACACTTCAAAACTGAATGACTATCAGGAAGAAGACCTGAAGATCTCAATAATTTTACCAACAACATTTGACTACACAGAAGAGTTGATCAAAGCAACAAAAGAAGACCCCCACCTGCAACTCTTGTTAAAAACAATAATGAAAGGGTTCCCAGAAAAGGCTGATCAACTCCCTACAGAACTGCATCACTACTTCAATTTCAAAGAAGAACTAACATACTTCAAAGGTCTAATTTTCAAAGGTCACAAAATTGTAGTGCCCAAAACACAAATACCTCAGATGCTAAAATACATACACCAAGGTCACCTTGGAATTCAGAGTTGCTTGAAAAGAGCACACCAATTACTCTATTGGAGAGGACAATATGAAGACATTGTGAAACTGGTTAAAAGCTGCTCAGCATGTGAAAAAACACAAAAGGACAATACCAATTATACCGTAGCAGTCAAAAGAATCCCATCTCTCCCATGGCAGATTGTGGCATCTGATTTATTTGAACTAAAAGGAAAACAGTATATTAAAGAATGGCGTTTCAAGCACTCAACATCCAGTCCTCACCACCCCCAAGGCAATGGCTTAGCCGAAAGAGCTGTCCAAACTGCAAAAAACCTACTAAGGAAATGCAGTATTGATAAATCGGATATCCAACTTGCTCTATTAAATTGGAGAAATACACCAAGAACAAACAATCTAGGGTCTCCTAATCAACGCCTCTACAGTAGAATAACACGATCATTAATACCTACAAGTGAAAATAATCTTAAACCAAAGATACTTCAAGGGGTCACATCCGAACTAAAGTACCTACGAAACAAACAAGCCAACCATAGCAACAAGCAACGTAAGGAGCCAACCAATTATGAACTCGACGACAGAATCAGACACAAAGTCGGTCATCGTCAATGGGAAGGAGCGAGAGTGATAGAAAAACCTAATAATCACCCGAGATCCATTATCATTAAAACTGACAAAGGACAAATATTCAGAAGAAACATTGGACACATACACAATACACTATCAGACCTATCAATTGGCAGCAAAGAAGCGGTTCCGGAAACAGTATATCCTGACGACTATCCACATGCCCAATCGGACAAACAACCGGAGCTACCTGCAGCAGCTACTACATCTCAAGAACAAACAACTATATCACCAAGGATTAATTGCAAAAGCAGCGCTTCAGAAGCACCCGTCATAACTAGCAGTGATCAACCGACTACAAGATGTTCAAGATTCGGAAGAACCATCAAACCAGTCGACAGACTAGATCTATAG
Protein
MATNNNEAVSGIKPPGYLHIESDNKSANWKKWRQQFEWYATAIQLGKKPADIQAATFMSIIGPDAIDIYNSFNLNTIDEQKLSIIIGKFEEYFAPKNNISFERYVFFKIEQHEDESFNEFITRIKTQANKCEFGTLLEEMLKDKIVFGIKSTQIREKLLTEEKLDLTKATAICKSSEQASKQLNEFENNNKSEKILTIKSKNFRNEKFDCKRCGSSHKARECQAYNKLCTKCNKAGHFAKMCRSQIQLKQKNKINTLEENSTSENSDESFIGQLSVGNSKDWTESVETANTKFTAKLDTGAECNVLPNFIVQKTHACIQPSRTKNLISYSNNRISVLGEVKLQCKIKKKTAKILFKVVAERVTPVLGLNTCEKLGLIARVETLKESSSNDDIFKGLGCYKNFEYDIDLIENPKFEIKPTRKVPHAIRNEVKQELDRMVKLDVITPETEPTPAVSPMVVVRQKGKLRICIDPSDVNKNILRRHFPLATIEEIAADIKGSEYFSLLDCTKGFWQIKLSKRTQKILTFSTPWGRYSFKRLPFGLSSAPEIFQEILTNLLSKFKNVKVSIDDIFIHAKKKEELQKTVKEVIETLKISGFKLNQSKCIFEAKRIKFLGHIVSAKGLEADPEKVKAIEFMKTPQNKKELQRILGMITYLNKYIPNMSELTNPLRDLLHKDTSFNWEFYHDEALNKIKKVLQNPPVLKLYDVNKPVTLSVDASSKNLGAALLQEGQPVAYGARTLTKSEQNYPQIEKEALAILFGCKKFHEYVYGKELLVESDHKPLETIFRKNIQSAPARFQRIMLNLTPYSPKITFKKGTEIPLADFLSRDCDTSKLNDYQEEDLKISIILPTTFDYTEELIKATKEDPHLQLLLKTIMKGFPEKADQLPTELHHYFNFKEELTYFKGLIFKGHKIVVPKTQIPQMLKYIHQGHLGIQSCLKRAHQLLYWRGQYEDIVKLVKSCSACEKTQKDNTNYTVAVKRIPSLPWQIVASDLFELKGKQYIKEWRFKHSTSSPHHPQGNGLAERAVQTAKNLLRKCSIDKSDIQLALLNWRNTPRTNNLGSPNQRLYSRITRSLIPTSENNLKPKILQGVTSELKYLRNKQANHSNKQRKEPTNYELDDRIRHKVGHRQWEGARVIEKPNNHPRSIIIKTDKGQIFRRNIGHIHNTLSDLSIGSKEAVPETVYPDDYPHAQSDKQPELPAAATTSQEQTTISPRINCKSSASEAPVITSSDQPTTRCSRFGRTIKPVDRLDL

Summary

EMBL
MRZV01000618    PIK46835.1    MRZV01000576    PIK47528.1    MRZV01000033    PIK61397.1    + More
HADY01023773    HAEJ01006887    SBS47344.1    HADZ01002490    HAEA01007842    SBQ36322.1    GEGO01004116    JAR91288.1    GEGO01004317    JAR91087.1    GBHO01004090    JAG39514.1    GDHC01013957    JAQ04672.1    HAEH01020882    SBS11479.1    GBGD01000115    JAC88774.1    GBGD01000119    JAC88770.1    GCES01096219    JAQ90103.1    ABLF02022355    ABLF02022359    ABLF02022361    ABLF02022365    ABLF02041467    ABLF02013930    ABLF02013934    AAGJ04164197    AAGJ04066141    GEZM01041944    JAV80090.1    GDIP01239061    JAI84340.1    GDIP01199810    GDIP01181260    GDIP01124130    GDIP01104931    GDIP01053137    GDIP01051184    JAL98783.1    GDIP01203362    JAJ20040.1    GDIP01019161    JAM84554.1    GDIP01102077    JAM01638.1    GDHC01017753    JAQ00876.1    GEZM01011167    JAV93617.1    GGMR01004179    MBY16798.1    GDIP01156216    JAJ67186.1    AAGJ04172695    KF319019    AIE48224.1    AAGJ04126635    GDIP01096578    JAM07137.1    AAGJ04068764    GDIP01073678    JAM30037.1    KK112400    KFM57554.1    GDIP01175260    GDIP01109876    JAL93838.1    GDIP01017210    JAM86505.1    GEGO01003204    JAR92200.1    GEZM01066276    JAV68015.1    GEZM01035137    JAV83383.1    GBBI01004745    JAC13967.1    MRZV01002352    PIK33923.1    GEZM01074317    JAV64601.1    HAEF01001580    SBR38962.1    GEZM01001973    JAV97431.1    HAEH01011921    SBR93481.1    GEGO01004733    JAR90671.1    GDKW01000526    JAI56069.1    GDIP01175266    GDIP01109877    JAL93837.1    GBHO01022049    GBHO01022048    JAG21555.1    JAG21556.1    GDIP01122420    JAL81294.1    HADY01017769    SBP56254.1    GDIP01192261    JAJ31141.1    GBBI01004851    JAC13861.1    KK122208    KFM82237.1    AAGJ04077500    GEGO01004841    JAR90563.1    GBBI01004852    JAC13860.1    GBHO01036465    JAG07139.1    GECL01002751    JAP03373.1    GDIP01210008    JAJ13394.1   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00665   rve
PF00098   zf-CCHC
PF03732   Retrotrans_gag
Interpro
IPR001584   Integrase_cat-core        + More
IPR041577   RT_RNaseH_2       
IPR001878   Znf_CCHC       
IPR012337   RNaseH-like_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR001995   Peptidase_A2_cat       
IPR036875   Znf_CCHC_sf       
IPR005162   Retrotrans_gag_dom       
IPR001969   Aspartic_peptidase_AS       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
Gene 3D
PDB
4OL8     E-value=7.34022e-49,     Score=494

Ontologies

Topology

Length:
1251
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00374
Exp number, first 60 AAs:
0.00173
Total prob of N-in:
0.00018
outside
1  -  1251
 
 

Population Genetic Test Statistics

Pi
395.565447
Theta
205.630573
Tajima's D
3.235804
CLR
0.355135
CSRT
0.987200639968002
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号