SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14917  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA000775
Annotation
PREDICTED:_juvenile_hormone_esterase-like_isoform_X2_[Bombyx_mori]
Full name
Carboxylic ester hydrolase       + More
Juvenile hormone esterase      
Location in the cell
PlasmaMembrane   Reliability : 2.826
 

Sequence

CDS
ATGGATTTAGAGACATCTGTATTTATAACAGCAGTATATGGAGAGTTCTGCATCACAGAATGTGAGGTTCCAGTGAATATCGACTCAGGACCAGTGTGCGGGAGAGAAGAAACTGCAGAGAACAATACGAAATACTACAGCTTTCAAGGTATTCCGTATGCGAAACCACCGGTAGGATCCAAGAGATTTGCGGAACTAGAACCTATTGAGTCGTGGAGTGATCCATTTTATGCTTACGAGGAAGGACCGGCTTGTCCATCAAGAGACCTTGTCTACGGCAGCATCACCGTGAAACCTAAAGGCATGAGTGAAGACTGTATCTATGTTAACGTCTTTGTACCGGCCACTGCATGTTTGGACTGTGATTGTCTTAAGGACGACCTACTGCCTATACTGGTGAACATTCACGGAGGTACATTCAATACTGGGTCTGGAAATAGAGATTTGCATGGACCAGAATTATTAATGGTGAAAAATGTCATTGTAATTAATTTTAACTTCAGGTTGGCAGTATTTGGATACTTGTCTCTTGCCTCTGGCAAGATCCCAGGTAACAACAGTCTGCGCGACATGGTCACACTGTTACAGTGGGTTCAGAGAAACGCGCGCGCCTTTGGAGGGGATCCTAGACGAGTGACATTGCTTGGAGAAAGTTCTGGAGCAGCATCGGTTCACCTTTTAATGTTATCCCAAGCCGCTAGAGGACTTTTCGAGAAAGGTATAATAATGAGTGGCTCCGCTATGGCAAATTTCTACACTGCATCTCCAATATACGCTAAAATGATCGCCGAAATGTTCCTCCAAGAACTGGGTTTGAATTGTACTGATCCTGATGAAATTCATAAGACACTGACTGAACTACCTTTAGAAGATATAATGAGAGCCAATGATGTTGTGCAATATAAAACAGGTCCCACCTCGTTCGCACCGGTCGTTGAGATAGAGGATCACGAATATACCAGAATTATTGACGATGACCCCATAGCTCTCATCGCACAAGGTCGAGCAAAAGATATTCCACTACTAATGGGTTTCAATCGCGATGAAGGAGAATTTGCCAAATGGATTATAATGATTTTGGATGTTGTGAATCGTTATAAAAGTAATCCTGCAATCATATTAGGACTAAGACTAGCGTACGCATTGCCTTCTGAGGAAGCTTTCGCGAAAGGAAGGTTTGTGGGAAAAAGATATTTTGATGGTGAACCCACATTGGATGGGTTAGCAAAAAGTATGACGGATATTCTATTTCAATATTCTATGATAAAACTGGCACAATGGAGAGTATTGTTGAGATCAGCGCCGACGTATTTCTACCTATTTTCGTATGAGAGTGATTTTAGCAGTGTAAAGAGAGCCAACTGGTTAAGTTACAAAGGAACGGCCCACGTCGAGGATCTGACGTACGTGTTTCGCACCACTACATTTCTTCGCGATCACGTGTCGATTCCTCCTCAGACTAGGGATGATCACATGAGGGATTGGATGTCCACTTTGTTCAGTAACTACGTAAAATGCAAGTCAGTATTGTTCTTTCATACAAAATGCACGATGGTTCTTGGCTTGGTTCACCTGATCGTGGACTCACGTTTGAAGTTTTGTTTCAGTAACCCGACATGCACTGAGCTCGATGATCCTCGGTGGCCCCCCACCGATATGAAAGAGTTGATGTATCAAGTCATTCGAGAGCCTCATGTTTACAATATGTCCACTCTATCCGACGAGTTGATGGAAATGGTGGAGTTTGTCGACAGCGTCGACGACCAAGTCAGGAAAGGACTGTCTGACTTCATTGTTTAG
Protein
MDLETSVFITAVYGEFCITECEVPVNIDSGPVCGREETAENNTKYYSFQGIPYAKPPVGSKRFAELEPIESWSDPFYAYEEGPACPSRDLVYGSITVKPKGMSEDCIYVNVFVPATACLDCDCLKDDLLPILVNIHGGTFNTGSGNRDLHGPELLMVKNVIVINFNFRLAVFGYLSLASGKIPGNNSLRDMVTLLQWVQRNARAFGGDPRRVTLLGESSGAASVHLLMLSQAARGLFEKGIIMSGSAMANFYTASPIYAKMIAEMFLQELGLNCTDPDEIHKTLTELPLEDIMRANDVVQYKTGPTSFAPVVEIEDHEYTRIIDDDPIALIAQGRAKDIPLLMGFNRDEGEFAKWIIMILDVVNRYKSNPAIILGLRLAYALPSEEAFAKGRFVGKRYFDGEPTLDGLAKSMTDILFQYSMIKLAQWRVLLRSAPTYFYLFSYESDFSSVKRANWLSYKGTAHVEDLTYVFRTTTFLRDHVSIPPQTRDDHMRDWMSTLFSNYVKCKSVLFFHTKCTMVLGLVHLIVDSRLKFCFSNPTCTELDDPRWPPTDMKELMYQVIREPHVYNMSTLSDELMEMVEFVDSVDDQVRKGLSDFIV

Summary

Description
JH esterase plays a crucial role in the decrease of JH activity in lepidopteran insects, by hydrolyzing the methyl ester of JH. It is also involved in the transport of JH.
Catalytic Activity
H2O + juvenile hormone I = H(+) + juvenile hormone I carboxylate + methanol
H2O + juvenile hormone III = H(+) + juvenile hormone III carboxylate + methanol
Similarity
Belongs to the type-B carboxylesterase/lipase family.
Keywords
Direct protein sequencing   Disulfide bond   Glycoprotein   Hydrolase   Serine esterase   Signal  
Feature
chain  Carboxylic ester hydrolase
EC Number
3.1.1.-
3.1.1.59
EMBL
BABH01034171    BABH01034174    AB543061    BAJ11978.1    BABH01034170    FJ652458    + More
ACV60242.1    KZ149945    PZC76778.1    HQ588158    ADU25009.1    PZC76779.1    KX015865    ARM65394.1    EU178813    ABW24129.1    AF327882    AAG42021.2    KY021876    AQY62765.1    AF287267    AAL55240.1    BABH01034175    AGBW02014918    OWR40861.1    AY489292    AAR37335.1    JTDY01001282    KOB74302.1    JX866744    AGS49148.1    ADU25010.1    AF037197    AAB96654.1    AF037196    AAC38822.1    PZC76780.1    J04955    KU375426    APD13868.1    HQ588155    ADU25006.1    HM588760    AEB77712.1    JQ901384    AGB93712.1    ODYU01010342    SOQ55377.1    KQ459604    KPI92141.1    FJ652445    ACV60229.1    KQ460205    KPJ17063.1    KOB74303.1    ODYU01007337    SOQ50016.1    KY938807    ASA46448.1    LC012033    BAR88201.1    ODYU01008725    SOQ52573.1    FJ997319    ADF43484.1    FJ875998    ACO81854.2    KM926341    AJR27471.1    EU523701    ACB12192.1    KU215370    AMB19664.1    AF153367    AAD34172.1    KX015857    ARM65386.1    RSAL01000057    RVE49776.1    KP938886    AKS40367.1    HQ588156    ADU25007.1    RVE49777.1    GEYN01000073    JAV02056.1    ADU25011.1    KY021831    AQY62720.1    GEYN01000067    JAV02062.1    KOB74304.1    GEYN01000059    JAV02070.1    KY021836    AQY62725.1    GEYN01000072    JAV02057.1    GEYN01000063    JAV02066.1    KY021830    AQY62719.1    GEYN01000064    JAV02065.1    KY021861    AQY62750.1    AJ845189    CAH60166.1    AJ845190    CAH60167.1    AJ845187    CAH60164.1    AJ845188    CAH60165.1    AJ844897    CAH59956.1    GALX01003004    JAB65462.1    KU215371    AMB19665.1    KU215373    AMB19667.1    KQ971352    KYB26709.1    KQ460323    KPJ15853.1    EFA06763.1    NEVH01002552    PNF42088.1    ATLV01011653    KE524705    KFB36098.1    GEBQ01014077    JAT25900.1    APCN01000584    GEBQ01002779    JAT37198.1    AXCN02000324    NWSH01003954    PCG65624.1    MF687564    ATJ44490.1    CVRI01000059    CRL02968.1    ODYU01000269    SOQ34744.1    AJ845191    CAH60168.1    MF687633    ATJ44559.1    AAAB01008859    EAA07742.3    GQ180944    ACT53736.1    HQ122616    AEL33699.1    JN019808    AEJ18172.1    KP859354    AKZ17664.1    PNF42097.1    KQ459592    KPI96776.1    PNF42100.1    PNF42099.1    KM234964    AIY68378.1   
Pfam
PF00135   COesterase        + More
PF00083   Sugar_tr
PF10300   DUF3808
Interpro
IPR029058   AB_hydrolase        + More
IPR002018   CarbesteraseB       
IPR019826   Carboxylesterase_B_AS       
IPR019819   Carboxylesterase_B_CS       
IPR000997   Cholinesterase       
IPR005829   Sugar_transporter_CS       
IPR020846   MFS_dom       
IPR036259   MFS_trans_sf       
IPR005828   MFS_sugar_transport-like       
IPR002168   Lipase_GDXG_HIS_AS       
IPR019412   Iml2/TPR_39       
IPR011990   TPR-like_helical_dom_sf       
SUPFAM
SSF53474   SSF53474        + More
SSF103473   SSF103473       
SSF48452   SSF48452       
Gene 3D
PDB
2FJ0     E-value=2.50468e-128,     Score=1176

Ontologies

Topology

Length:
599
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.80856
Exp number, first 60 AAs:
0.00143
Total prob of N-in:
0.00820
outside
1  -  599
 
 

Population Genetic Test Statistics

Pi
176.738796
Theta
170.308987
Tajima's D
0.650854
CLR
0.628512
CSRT
0.55647217639118
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
25860555 EAIEQSR 96.15 4e-12
25860555 TDEPGQYQIEQDSQHFIIGITPIK 100.00 7e-07
24093152 TGPPAVEVTSAEQAK 100.00 7e-07
27102218 IAYAIPSEEAFAK 100.00 7e-07
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号