Gene

KWMTBOMO14911  Validated by peptides from experiments

Pre Gene Modal

BGIBMGA000786

Annotation

PREDICTED:_ADP-ribosylation_factor-like_protein_2_[Plutella_xylostella]

Location

Bomo_Chr25(+):260413-264879      View in EpiBrowser

Full name

ADP-ribosylation factor-like protein 2      

Location in the cell

Cytoplasmic   Reliability : 1.175 Mitochondrial   Reliability : 1.683

CDS

ATGGGTTTCTTGACAATTCTAAAGAAGCTGCGGCAGAAAGAGAAGGAAATGCGAATACTTATGTTAGGCCTAGACAATGCAGGGAAGACAACAATTTTGAAACGATTTAATGGTGAACCAATTGACACTATTTCTCCAACACTAGGCTTCAACATAAAAACTTTAGAACATAAGGGATTTAAGTTGAACATTTGGGATGTTGGGGGACAAAAGTCTTTGAGATCATACTGGAAGAACTACTTCGAGAGTACGGATGGAGTAGCGTGGGTGGTGGACGCGGCGGACGGGGCGCGACTGTCGGCGTGCGCGGCAGAACTCCGCGCGCTGCTCACGGAGGAGCGTCTGGCGGCCGCCACGCTGCTCGTGCTCGCCAACAAGTGCGACCTACCCGGAGCACTCTCCTTGCAACAAATACGAGAGGCTCTAGATCTCGACAGCATAAAATCTCATCACTGGCGCATCGTGAGGTGCTCTGCAGTCACCGGAGAGAACCTTTTAGAAGGAATCGACTGGATGTTAGACGATATTGCGTCGAGAATATTCACTCTAGACTGA

Protein

MGFLTILKKLRQKEKEMRILMLGLDNAGKTTILKRFNGEPIDTISPTLGFNIKTLEHKGFKLNIWDVGGQKSLRSYWKNYFESTDGVAWVVDAADGARLSACAAELRALLTEERLAAATLLVLANKCDLPGALSLQQIREALDLDSIKSHHWRIVRCSAVTGENLLEGIDWMLDDIASRIFTLD

Description

Small GTP-binding protein which cycles between an inactive GDP-bound and an active GTP-bound form, and the rate of cycling is regulated by guanine nucleotide exchange factors (GEF) and GTPase-activating proteins (GAP). GTP-binding protein that does not act as an allosteric activator of the cholera toxin catalytic subunit. Regulates formation of new microtubules and centrosome integrity. Prevents the TBCD-induced microtubule destruction. Participates in association with TBCD, in the disassembly of the apical junction complexes. Antagonizes the effect of TBCD on epithelial cell detachment and tight and adherens junctions disassembly. Together with ARL2, plays a role in the nuclear translocation, retention and transcriptional activity of STAT3. Component of a regulated secretory pathway involved in Ca(2+)-dependent release of acetylcholine. Required for normal progress through the cell cycle.
Small GTP-binding protein which cycles between an inactive GDP-bound and an active GTP-bound form, and the rate of cycling is regulated by guanine nucleotide exchange factors (GEF) and GTPase-activating proteins (GAP). GTP-binding protein that does not act as an allosteric activator of the cholera toxin catalytic subunit. Regulates formation of new microtubules and centrosome integrity. Prevents the TBCD-induced microtubule destruction. Participates in association with TBCD, in the disassembly of the apical junction complexes. Antagonizes the effect of TBCD on epithelial cell detachment and tight and adherens junctions disassembly. Together with ARL2, plays a role in the nuclear translocation, retention and transcriptional activity of STAT3. Component of a regulated secretory pathway involved in Ca(2+)-dependent release of acetylcholine. Required for normal progress through the cell cycle (By similarity).

Subunit

Found in a complex with ARL2, ARL2BP and SLC25A6. Found in a complex with at least ARL2, PPP2CB, PPP2R1A, PPP2R2A, PPP2R5E and TBCD. Interacts with ELMOD2. The GTP-bound form interacts with ARL2BP. Interacts with TBCD; the GDP-bound form interacts preferentially with TBCD. Interacts with UNC119 (By similarity). Found in a complex with ARL2, ARL2BP and SLC25A4. The GTP-bound form interacts with PDE6D.
Found in a complex with ARL2, ARL2BP and SLC25A6. Found in a complex with at least ARL2, PPP2CB, PPP2R1A, PPP2R2A, PPP2R5E and TBCD. Found in a complex with ARL2, ARL2BP and SLC25A4. The GTP-bound form interacts with PDE6D. Interacts with ELMOD2. The GTP-bound form interacts with ARL2BP. Interacts, preferentially in its GDP-bound state, with TBCD. Interacts with UNC119.
Found in a complex with ARL2, ARL2BP and SLC25A6. Found in a complex with at least ARL2, PPP2CB, PPP2R1A, PPP2R2A, PPP2R5E and TBCD. Interacts with ELMOD2. The GTP-bound form interacts with ARL2BP. The GDP-bound form interacts preferentially with TBCD. Interacts with UNC119. Found in a complex with ARL2, ARL2BP and SLC25A4. The GTP-bound form interacts with PDE6D (By similarity).
Interacts with ELMOD2. Interacts with ARL2BP; the GTP-bound form interacts with ARL2BP. The GDP-bound form interacts preferentially with TBCD. Interacts with UNC119. Found in a complex with ARL2, ARL2BP and SLC25A4. The GTP-bound form interacts with PDE6D (By similarity). Found in a complex with ARL2, ARL2BP and SLC25A6. Found in a complex with at least ARL2, PPP2CB, PPP2R1A, PPP2R2A, PPP2R5E and TBCD.

Similarity

Belongs to the small GTPase superfamily. Arf family.

Keywords

3D-structure   Cell cycle   Complete proteome   Cytoplasm   Cytoskeleton   GTP-binding   Isopeptide bond   Lipoprotein   Mitochondrion   Myristate   Nucleotide-binding   Nucleus   Phosphoprotein   Reference proteome   Ubl conjugation   Alternative splicing   Polymorphism  

Feature

chain  ADP-ribosylation factor-like protein 2
splice variant  In isoform 2.
sequence variant  In dbSNP:rs664226.

Uniprot

A0A194RGX5   I4DP88   A0A2H1W2R7   A0A212EGZ5   A0A2W1BT10   A0A2A4J391   + More
A0A1E1W6W8   J3JY06   H9IU56   A0A3S0ZJG6   A0A0B6ZUQ0   A0A2U9BAA7   A0A2C9JEU8   G3Q8H1   G1C2I8   I3K7D0   A0A3P8QR07   A0A3P9B335   A0A3Q0QTC2   K1RUY4   A0A3Q3R5E9   N6TNK7   I3N6L1   A0A3Q1AKG1   A0A3P8TXC6   F6RR25   A0A3B5BAX7   A0A1U8DFC6   A0A3Q1EQ76   A0A3Q1INZ5   G3QRA0   A0A2R9C7Z2   A0A2K6FWW4   K7CT71   A0A3B4WDX5   A0A3B4VGI2   A0A2K5WTW8   A0A0D9R5D2   A0A2K6NI28   A0A2K5L9F0   A0A2K5KFV8   H9ESA6   Q9D0J4   V3ZG06   A0A2K6AME1   A0A2U3Y0C8   A0A3B4GTJ1   L5KQZ6   A0A3Q3A154   A0A096N6Q0   A7STE6   A0A3Q3LF30   A0A3Q7TY33   H0XZF2   A0A1U7Q4W4   G1Q1M1   L5LEQ8   A0A3Q7R312   A0A2U3VGY0   A0A3Q7UFT0   Q53YD8   P36404   A0A1A8C0S3   O08697   K9IGY1   A0A2I4C3C6   L8IPX1   W5PP36   Q2TA37   G5B6M8   K7G987   A0A1J1HGL1   A0A341BTR7   A0A2U4CAZ7   A0A2Y9PV80   A0A2Y9FBX6   U3AVV9   A0A146NXT7   U3D220   A0A1A8R6R6   A0A1A8KGZ5   A0A1A8APT9   A0A0E9X524   A0A2Y9JP06   M3YM18   A0A340XL08   A0A2D4P442   A0A1A8LHQ7   A0A3P8WHU4   A0A3B5KNA9   C3Z2D6   A0A3P9Q8C1   A0A0S7H0T4   A0A3B3VKE9   A0A287B226   A0A2K6MKG5   A0A077W8T9   A0A2Y9GN60   A0A1S2ZFN0   A0A091DDS4  

Pubmed

26354079    22651552    22118469    28756777    22516182    19121390    + More
15562597    25186727    22992520    23537049    19892987    22398555    22722832    16136131    25362486    17431167    25319552    16141072    15489334    11809823    15979089    21183079    11980706    23254933    23258410    17615350    21993624    8125298    9373149    11181995    8415637    15146197    16554811    10488091    10831612    11303027    11847227    16525022    17452337    18588884    18234692    18981177    20740604    21269460    27666374    19368893    9208929    12527357    12912990    22673903    22751099    20809919    17704193    21993625    17381049    25243066    25613341    24487278    21551351    18563158    30723633   

EMBL

KQ460205    KPJ17068.1    AK403472    KQ459604    BAM19728.1    KPI92147.1    + More
ODYU01005693    SOQ46804.1    AGBW02014998    OWR40741.1    KZ149945    PZC76784.1    NWSH01003483    PCG66206.1    GDQN01008463    JAT82591.1    BT128129    AEE63090.1    BABH01034161    RQTK01000397    RUS80356.1    HACG01025448    CEK72313.1    CP026246    AWP00891.1    JF728807    AEJ38209.1    AERX01028350    JH817779    EKC38536.1    APGK01057871    KB741282    KB632233    ENN70840.1    ERL90418.1    AGTP01072426    CABD030079703    AJFE02101268    AACZ04016214    GABC01010578    GABF01004566    GABD01008716    GABE01008841    GABE01008840    JAA00760.1    JAA17579.1    JAA24384.1    JAA35898.1    AQIA01019877    AQIB01078739    JSUE03012071    JSUE03012072    JU321509    JU473700    JV045755    AFE65265.1    AFH30504.1    AFI35826.1    AF143680    AK011366    BC060259    KB202481    ESO90138.1    KB030625    ELK13371.1    AHZZ02006315    AHZZ02006316    DS469795    EDO32994.1    AAQR03147593    AAQR03147594    AAPE02049467    KB112964    ELK24366.1    BT006674    AK223502    CH471076    AAP35320.1    BAD97222.1    EAW74332.1    L13687    AF493888    CN338497    AP000436    BC002530    HADZ01009218    HAEA01012736    SBP73159.1    Y12708    GABZ01008152    JAA45373.1    JH880973    ELR57569.1    AMGL01061832    AMGL01061833    BC111133    JH168664    GEBF01006702    EHB04905.1    JAN96930.1    AGCU01174361    CVRI01000003    CRK87011.1    GAMT01007473    JAB04388.1    GCES01150452    JAQ35870.1    GAMT01007474    GAMT01007472    GAMR01001524    GAMR01001523    GAMR01001522    GAMQ01002843    JAB04387.1    JAB32408.1    JAB39008.1    HAEI01007238    HAEH01016435    SBS00944.1    HAED01006307    HAEE01011670    SBR31720.1    HADY01018213    HAEJ01016484    SBP56698.1    GBXM01010770    JAH97807.1    AEYP01074240    IACN01045812    LAB52741.1    HAEF01006750    HAEG01013983    SBR44132.1    GG666574    EEN53187.1    GBYX01446759    JAO34687.1    AEMK02000006    DQIR01149383    DQIR01295787    HDB04860.1    LK023313    CDS03456.1    KN122776    KFO28430.1   

Proteomes

UP000053240    UP000053268    UP000007151    UP000218220    UP000005204    UP000271974    + More
UP000246464    UP000076420    UP000007635    UP000005207    UP000265100    UP000265160    UP000261340    UP000005408    UP000261600    UP000019118    UP000030742    UP000005215    UP000257160    UP000265080    UP000002281    UP000261400    UP000189705    UP000257200    UP000265040    UP000001519    UP000240080    UP000233160    UP000002277    UP000261360    UP000261420    UP000233100    UP000029965    UP000233200    UP000233060    UP000233080    UP000006718    UP000000589    UP000030746    UP000233120    UP000245341    UP000261460    UP000010552    UP000264800    UP000028761    UP000001593    UP000261640    UP000286640    UP000005225    UP000189706    UP000001074    UP000286641    UP000245340    UP000286642    UP000005640    UP000002494    UP000192220    UP000002356    UP000009136    UP000006813    UP000007267    UP000183832    UP000252040    UP000245320    UP000248483    UP000248484    UP000008225    UP000248482    UP000000715    UP000265300    UP000265120    UP000005226    UP000001554    UP000242638    UP000261500    UP000008227    UP000233180    UP000248481    UP000079721    UP000028990   

PRIDE

H9IU56    Q9D0J4    P36404    O08697    Q2TA37   

Pfam

PF00025   Arf

Interpro

IPR005225   Small_GTP-bd_dom        + More
IPR006689   Small_GTPase_ARF/SAR       
IPR027417   P-loop_NTPase       

SUPFAM

SSF52540   SSF52540       

ProteinModelPortal

A0A194RGX5   I4DP88   A0A2H1W2R7   A0A212EGZ5   A0A2W1BT10   A0A2A4J391   + More
A0A1E1W6W8   J3JY06   H9IU56   A0A3S0ZJG6   A0A0B6ZUQ0   A0A2U9BAA7   A0A2C9JEU8   G3Q8H1   G1C2I8   I3K7D0   A0A3P8QR07   A0A3P9B335   A0A3Q0QTC2   K1RUY4   A0A3Q3R5E9   N6TNK7   I3N6L1   A0A3Q1AKG1   A0A3P8TXC6   F6RR25   A0A3B5BAX7   A0A1U8DFC6   A0A3Q1EQ76   A0A3Q1INZ5   G3QRA0   A0A2R9C7Z2   A0A2K6FWW4   K7CT71   A0A3B4WDX5   A0A3B4VGI2   A0A2K5WTW8   A0A0D9R5D2   A0A2K6NI28   A0A2K5L9F0   A0A2K5KFV8   H9ESA6   Q9D0J4   V3ZG06   A0A2K6AME1   A0A2U3Y0C8   A0A3B4GTJ1   L5KQZ6   A0A3Q3A154   A0A096N6Q0   A7STE6   A0A3Q3LF30   A0A3Q7TY33   H0XZF2   A0A1U7Q4W4   G1Q1M1   L5LEQ8   A0A3Q7R312   A0A2U3VGY0   A0A3Q7UFT0   Q53YD8   P36404   A0A1A8C0S3   O08697   K9IGY1   A0A2I4C3C6   L8IPX1   W5PP36   Q2TA37   G5B6M8   K7G987   A0A1J1HGL1   A0A341BTR7   A0A2U4CAZ7   A0A2Y9PV80   A0A2Y9FBX6   U3AVV9   A0A146NXT7   U3D220   A0A1A8R6R6   A0A1A8KGZ5   A0A1A8APT9   A0A0E9X524   A0A2Y9JP06   M3YM18   A0A340XL08   A0A2D4P442   A0A1A8LHQ7   A0A3P8WHU4   A0A3B5KNA9   C3Z2D6   A0A3P9Q8C1   A0A0S7H0T4   A0A3B3VKE9   A0A287B226   A0A2K6MKG5   A0A077W8T9   A0A2Y9GN60   A0A1S2ZFN0   A0A091DDS4  

PDB

1KSJ     E-value=3.09289e-63,     Score=609

KEGG

101743220    K07943 ADP-ribosylation factor-like protein 2 | (RefSeq) ADP-ribosylation factor-like protein 2

GO

GO:0005525   GO:0005737   GO:0019003   GO:0031116   GO:0015630   GO:0005925   GO:0003924   GO:0005829   GO:0051457   GO:0005730   GO:0005813   GO:0007098   GO:0005794   GO:0005758   GO:0034260   GO:0015870   GO:0031113   GO:0070830   GO:0016328   GO:0010811   GO:0005634   GO:0050796   GO:0005095   GO:0007021   GO:0005759   GO:0034333   GO:0005739   GO:0005622   GO:0007264   GO:0006468   GO:0004672   GO:0004697   GO:0007154   GO:0016020   GO:0005112   GO:0015930  

Subcellular location

Mitochondrion intermembrane space   The complex formed with ARL2BP, ARL2 and SLC25A6 is expressed in mitochondria. Not detected in the Golgi, nucleus and on the mitotic spindle. Centrosome-associated throughout the cell cycle. Not detected to interphase microtubules (By similarity). The complex formed with ARL2BP, ARL2 and SLC25A4 is expressed in mitochondria.   With evidence from 4 publications.
Cytoplasm   The complex formed with ARL2BP, ARL2 and SLC25A6 is expressed in mitochondria. Not detected in the Golgi, nucleus and on the mitotic spindle. Centrosome-associated throughout the cell cycle. Not detected to interphase microtubules (By similarity). The complex formed with ARL2BP, ARL2 and SLC25A4 is expressed in mitochondria.   With evidence from 4 publications.
Cytoskeleton   The complex formed with ARL2BP, ARL2 and SLC25A6 is expressed in mitochondria. Not detected in the Golgi, nucleus and on the mitotic spindle. Centrosome-associated throughout the cell cycle. Not detected to interphase microtubules (By similarity). The complex formed with ARL2BP, ARL2 and SLC25A4 is expressed in mitochondria.   With evidence from 4 publications.
Microtubule organizing center   The complex formed with ARL2BP, ARL2 and SLC25A6 is expressed in mitochondria. Not detected in the Golgi, nucleus and on the mitotic spindle. Centrosome-associated throughout the cell cycle. Not detected to interphase microtubules (By similarity). The complex formed with ARL2BP, ARL2 and SLC25A4 is expressed in mitochondria.   With evidence from 4 publications.
Centrosome   The complex formed with ARL2BP, ARL2 and SLC25A6 is expressed in mitochondria. Not detected in the Golgi, nucleus and on the mitotic spindle. Centrosome-associated throughout the cell cycle. Not detected to interphase microtubules (By similarity). The complex formed with ARL2BP, ARL2 and SLC25A4 is expressed in mitochondria.   With evidence from 4 publications.
Nucleus   The complex formed with ARL2BP, ARL2 and SLC25A6 is expressed in mitochondria. Not detected in the Golgi, nucleus and on the mitotic spindle. Centrosome-associated throughout the cell cycle. Not detected to interphase microtubules (By similarity). The complex formed with ARL2BP, ARL2 and SLC25A4 is expressed in mitochondria.   With evidence from 4 publications.
Mitochondrion   The complex formed with ARL2BP, ARL2 and SLC25A4 is expressed in mitochondria. Not detected in the Golgi, nucleus and on the mitotic spindle. Centrosome-associated throughout the cell cycle. Not detected to interphase microtubules (By similarity). The complex formed with ARL2BP, ARL2 and SLC25A6 is expressed in mitochondria.   With evidence from 1 publications.

Length:

184

Number of predicted TMHs:

0

Exp number of AAs in TMHs:

0.00083

Exp number, first 60 AAs:

0

Total prob of N-in:

0.02901

outside

1  -  184

 

 

Pi

281.920175

Theta

184.896105

Tajima's D

1.735196

CLR

0.001963

CSRT

0.837458127093645

Interpretation

Uncertain