SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14908
Pre Gene Modal
BGIBMGA000783
Annotation
PREDICTED:_protein_serrate_[Bombyx_mori]
Full name
Delta-like protein      
Location in the cell
Extracellular   Reliability : 2.74
 

Sequence

CDS
ATGCGGGCGCGGTGTGTGCGGCGCGCGCCGCTGCTGCTCCTCCTCGCCCTCGCCTGCACGCTGCGTTGCGCGGCGGGGGCGGGCGTGTTCGAGCTTCAAATACTGGAATTTAGCAACTATCGGCTGGAGGTGGGGGCGGGCGGATGCTGCGGGGGCGGCGGTCCGAGGGGCGCGGGAGCGGCGGCCTGCTCGCATCCCTGCCGCACCAGGTTTACGCTCTGCCTCAAGGAGTACCAGTCGGCGGCCGCGCCCGGCGGGAGCTGCTCCTTCGGGCGCGCCGCCTCCCCCGTCCTCGGCACTGACTCCTTCACTCTGGCTGAGCCTCTCTACACCCTCGCACTGCCCTTCAGCTTCCGATGGACGCGTTCGTTCACGTTGATCCTGCAGGCGTATGACGACTACGAATACTCCGAGCCCGAAGCGGGGCTCATCGAGGAGGCGTGGTGGTCCGGGATCGTGGAGCCGAGCGCGGAGTGGCACGCGCTGCGCCACGCGGGCGCCGCGGCTGCCGTCGCGTACCGCGTGCGGGTGCTCTGTCAGCCCAACTACTACAATACGACCTGCACCACGTTTTGCCGGCCCAGGGACGACAAGTTCGGCCACTACTCGTGCACGCCCGACGGCGACAAGCACTGCCTGCCGGGCTGGCAGGGGGACAACTGCGAGAAACCTGTTTGTAAGGAAGGCTGTCACCCGACTCACGGACGTTGCGATCGGCCCGGGGACTGCGATTGTCGACCGGGATGGAGAGGTGAACTGTGTTCTCAGTGTCAGCCGTATCCGGGGTGTAAACACGGCTACTGCAACGGTTCCTCCTGGGACTGCACCTGCGACACGAACTGGGGCGGGATACTTTGTGACCAAGATTTAAACTACTGCGGCACCCACGAGCCATGTCAGCACGGAGGCACCTGTGAGAACACCGCGCCGGATCAGTACTTCTGTCGGTGCGCCGAGGGCTTCTCCGGGGTGGACTGCGAGCGCGTCGACAACCCGTGCGCGCCGCAGCCCTGCGCTCATGGCACGTGCTCCCTCGCCGGCACGACGCGAGGCTTCACGTGCACGTGCGACCGCGGCTGGGGCGGGCTGCTCTGCGACACCGACCTCGACGACTGCGCCAGCGGGCCCTGCCTGCACGGCGCGTCCTGCAGGGACCACCTCGACGGCTTCACCTGCGAATGCGCAGACGGCTGGACCGGGCCAGCCTGCGCCGAAGACGTCGACGAGTGCTCGGGTCGAAGCATGACGGAGGGCGCGCTGGGTCCGTGCGTGAACGCGGCGGCCTGCAACAACACGGCGGGCGGGTACTCGTGCGCCTGTCTGGCGGGCTGGACCGGCCGGGACTGCGAGACCAACGTGGACGACTGCACGGGACAGTGCCTGCACGGCGCCACCTGCATCGACCTGGTGGACGACTTCCACTGCGCCTGCGCGGCGGGCTACGCGGGCCGCACGTGTTCGCTGGACGTGGACGACTGCGCCCCCCGCCCTTGCACCAACGGCGGCGAGTGCGTCGACCTGCTCAACGCTTACCGCTGCATCTGCCCCGTCGGCTTCTCCGGCACCAACTGCGAGGACGACCGCGACCACTGCGCCGGCTCTCCGTGCGGCAACGGCGCCGCCTGCTACACCGCGCAGAGCGACTACTACTGCCACTGCGCGCCCGGCTGGACCGGCAAGAACTGCACGCAGCGAGCTGCCAGGGACCAGGTGAGCCGCTGCAGCCCCAGCCCCTGCCGCAACAACGCCTCCTGCGTGGAGTCCGCTGCCGACGTCACCTGCGTGTGTCGCGACGGCTACACAGGTAAAACCTGCTCAGTACTTGTAGAAGAGAGCGAGCGCTGTGCGGAAGGAATGTGCGCGAACGGAGGCACTTGTGTGCGCGAGGAGGGGTCCTGGCGCTGTCTGTGCGCTGCGGGTTGGGGGGGCGGCGCCTGTGACTCCCTGCTGCCGCTCGCGCCCGCAGCTCCTCCGCCGTGCCCGTGCCAGGCGGGGGGGACGTGTCTGCCGTCCGCACTGCCTCCCGGCTGGGCTTGCGGGTGCAGAGAAGGTCGTACCGGAGCCTTGTGCGAACTGTCCCTGGATCTCTGTGGCTCTTCGCCTTGTCGTAACGGCGGTCGGTGCGTCGGTGGCTCGGGGTGGTGGATGTGCGAATGTGTGGCGGGCTGGACCGGAGAGACTTGTGCAGTGCGAGTGTCCGCCCCGCCCCTCCTGTGCTCCCCGCCCTGTCCCGCCCCCGCTGCCTGCGTCGCCGACCCCGCACGTCCCTCTTCCACCCGGTGTCTCTGTCCGGCGCCGCCGCAGCGTGCTGCTAGACGCTGCCTCGAGACTGTTGCCGGCTTGGAAGCAGAGGGCGATGACGTAGACGTTCTACAAAACGACAACCATGGAGTGTACAACCGACCAGACCCGAACGTGGGCGACGGACCGGGAGCGTGCGGCGTCGCTAACGGCACCTGGTGGTGGGGATGTAACGCATGTTGGTGTAGTGGGGGGGTGCCAACCTGCACTCGACTGTGGTGCGGCCTGCCGGACTGCCTAGCTCCTAACGCACAACCCTGCCGAACCGATGAAGTGTGTGTACCGGCGGCACCAGCACTGTGCTTGCGTGCTCCATGTGCCGCACTGGGGGAGTGCCGGCGGGTGTCTGGACGACGTGTGGAGCCCCCCGCCCTCCCGGCACCCCCCGCGTGCTGGCCGGGAGCCCGCTCCCCCGCTCCCCCCGCCCTCTGTGCTCGTGCTCAGCTGCAGCTCGCGAGGGAGCGGCTGGGACCGGGCGCGCACGTGGAGCGTGCCTGTGGAGCTCTGCGACGAGCGTTGGCTGCCGCTCTTGCCGTTCAAGACCCTCCGCCCCCACCACTGGCGTTACTTTGTGATCTCGCACCGGATGATGATGACGCCCTCGATCTCGCTTTGTGGATCGGAGACGAAGTGGGTTCAGACGGAGCCTCCGGTGCAGCGGCGCTTGGAACTGCAGTGCGGGCTCTCGGAGAGCTTGTGTCGCGTCGGCGGCTGGCCCGTCACGCCCTGCTCGGGGCAGTGCTGCGACTCCGCATGCCGCCAATAGCGCCGCCGGCCTCAGAGCCATCGACAGCGCCGGCGACCACTATCGCGGTCGGTCTACCGGTGGTGCTGCTAGTAGTGGCCGCGGCCATTGGCGCCTTCCTGTTCGTGCGGAGGAGACGTGTGGCGGCAGCGGAACGGTCACGGCGCTGCGACGAAGAGAAGTCTAACAACCTTCAAAACGAGGAGAACTTGCGGCGGTACGCAAACCCCCTGCGCGAGGAGCGTGGCGGGACCCGCGGCGAGGACCTGCCTCGGGCCCATTCGCTGTACAAGGCGCAGAACGCGGACGCGCGGAACGACACGCCGCCGCGGGACAAGGAGCTCACCCTCCGCGCCCTGCCGCCCCCCGAGCCGCCGCCCCCCGCGCGCCACCCGCCGCCCGAGCGACTCACTGTACTCGTGTGA
Protein
MRARCVRRAPLLLLLALACTLRCAAGAGVFELQILEFSNYRLEVGAGGCCGGGGPRGAGAAACSHPCRTRFTLCLKEYQSAAAPGGSCSFGRAASPVLGTDSFTLAEPLYTLALPFSFRWTRSFTLILQAYDDYEYSEPEAGLIEEAWWSGIVEPSAEWHALRHAGAAAAVAYRVRVLCQPNYYNTTCTTFCRPRDDKFGHYSCTPDGDKHCLPGWQGDNCEKPVCKEGCHPTHGRCDRPGDCDCRPGWRGELCSQCQPYPGCKHGYCNGSSWDCTCDTNWGGILCDQDLNYCGTHEPCQHGGTCENTAPDQYFCRCAEGFSGVDCERVDNPCAPQPCAHGTCSLAGTTRGFTCTCDRGWGGLLCDTDLDDCASGPCLHGASCRDHLDGFTCECADGWTGPACAEDVDECSGRSMTEGALGPCVNAAACNNTAGGYSCACLAGWTGRDCETNVDDCTGQCLHGATCIDLVDDFHCACAAGYAGRTCSLDVDDCAPRPCTNGGECVDLLNAYRCICPVGFSGTNCEDDRDHCAGSPCGNGAACYTAQSDYYCHCAPGWTGKNCTQRAARDQVSRCSPSPCRNNASCVESAADVTCVCRDGYTGKTCSVLVEESERCAEGMCANGGTCVREEGSWRCLCAAGWGGGACDSLLPLAPAAPPPCPCQAGGTCLPSALPPGWACGCREGRTGALCELSLDLCGSSPCRNGGRCVGGSGWWMCECVAGWTGETCAVRVSAPPLLCSPPCPAPAACVADPARPSSTRCLCPAPPQRAARRCLETVAGLEAEGDDVDVLQNDNHGVYNRPDPNVGDGPGACGVANGTWWWGCNACWCSGGVPTCTRLWCGLPDCLAPNAQPCRTDEVCVPAAPALCLRAPCAALGECRRVSGRRVEPPALPAPPACWPGARSPAPPALCARAQLQLARERLGPGAHVERACGALRRALAAALAVQDPPPPPLALLCDLAPDDDDALDLALWIGDEVGSDGASGAAALGTAVRALGELVSRRRLARHALLGAVLRLRMPPIAPPASEPSTAPATTIAVGLPVVLLVVAAAIGAFLFVRRRRVAAAERSRRCDEEKSNNLQNEENLRRYANPLREERGGTRGEDLPRAHSLYKAQNADARNDTPPRDKELTLRALPPPEPPPPARHPPPERLTVLV

Summary

Description
Putative Notch ligand involved in the mediation of Notch signaling.
Feature
chain  Delta-like protein
Pfam
PF12661   hEGF        + More
PF07657   MNNL
PF00008   EGF
PF01414   DSL
PF07645   EGF_CA
Interpro
IPR000152   EGF-type_Asp/Asn_hydroxyl_site        + More
IPR000742   EGF-like_dom       
IPR018097   EGF_Ca-bd_CS       
IPR013032   EGF-like_CS       
IPR026219   Jagged/Serrate       
IPR009030   Growth_fac_rcpt_cys_sf       
IPR001774   DSL       
IPR011651   Notch_ligand_N       
IPR001881   EGF-like_Ca-bd_dom       
IPR001007   VWF_dom       
IPR033108   Jag2       
SUPFAM
SSF57184   SSF57184       
PDB
4XBM     E-value=1.18461e-81,     Score=777

Ontologies

Topology

Subcellular location
Membrane  
SignalP
Position:   1 - 26,         Likelihood:  0.994418
 
 
Length:
1156
Number of predicted TMHs:
2
Exp number of AAs in TMHs:
43.54429
Exp number, first 60 AAs:
20.82603
Total prob of N-in:
0.94975
POSSIBLE N-term signal
sequence
inside
1  -  11
TMhelix
12  -  34
outside
35  -  1035
TMhelix
1036  -  1058
inside
1059  -  1156
 
 

Population Genetic Test Statistics

Pi
303.639936
Theta
232.033685
Tajima's D
0.749953
CLR
0.429209
CSRT
0.592620368981551
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号