SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14898  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA012177
Annotation
PREDICTED:_uncharacterized_protein_LOC105388498_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 3.755
 

Sequence

CDS
ATGGACAAACTTGAACTTCAATCAACTTGTTTCGAGAATATCAAGACTTTGTGTACAAACTACCGCAAAGATTCTTCGTCTCGAAAAACTGAAGAGTACCTCAACATACGTTTGTCATCTTTGGAAGAACAGTGGAGAGACTTCGAGGCGAGAAATGCCTTATTACTATTGGAACTGGAAGACAAAACTATACATTATTTCTCTGAAGACGTTTACAACAAAACTAAAGAAATGTATCTAGCAACAAAAACAGACTTAAACAACAGACTTAAATACTTGAAACAGCAAAAACATAGTGTGAATTTTGATTTAAGTGACATTTCTATTGACTACACTCAAGACTGCGAGGACGGAAAATCTGAGAAAATACAACAACTTTTAAATAAACAAGAATGCAATTTTAATGCGATTTATCATGCATTGTCTAAAATTGACATCATTAGAACTAGTGAAAAGTGGGAGCTGGAAGATAATTTTAACATTTTAAAATCGAAGTGGGAGTCCATCGACAAACTGCACTGGGAAATTGACTTTCAGCTGAAGGGGTCTAACGATCACTATTACCGCATGTACTCAGATATCGAAGAAAAATATGATGAATTGAGAAAACAACTTCAATCTAAAATTTGGTCGAATGCACACTATCAGCAGTCGACACCGAGAATGGAATTACCTGATTTTTACGGAAACTACAGTAAGTGGATCTCTTTTAAGGATCTGTTTCTCGAAACCATCCATAACAACCCAACAATTAACAAAGCGCAAAAAATGAAACACCTGAAAACCAAATTGAAGGGGGAAGCAGAAAGTCTGGTACAGCATTTATCCGTCTGTGCTGAAAACTACAACTCCTGCTGGGATATTTTAGTGCAACGGTATGATAATCGCCGCCTACAATTTTCATCGTTTTTCAACACAATGATGAGTCTCCCTGTTATACATCAACCCGACGCTAACAATCTCAAGAAAATGCATGACGTCATTAAGGAATGCATGAACGGCATAGCTAACATCGGGCTGGATACGGCAACGTGGGATCCAATGATCGTGCATTTAATGTTGCCGAAATTAGATTCAACAACTTTAAATGATTATATGAACGAAATCCGAGATCACAGAGAATTACAAAACTTGCAAGATTTTTTATATTTTTTGGAGTGCAAGTTTATGGCATATGAAACTGCAAAATCAACAAAATCTGTTAAAAATACCACTTCCGAAAAAACATCTCATTGGAAACCGGCTAACAACAAACAACCTGTAAAAAAATTTACATATGACTCTAAGAAAACTTATAACTATCACGCTACTTATGGAAAATGCCCGAATTGTAATGGAAATCATGTTTTAATGCAATGTGCTAAATTTATTAACATGGATACTGCACAGCGAAACCACACTGTTGCGAAATTGAAACTCTGCAAAAATTGTCTCTATAGCCACAATAACGAAGAATGTAAATCAGCGAAAACGTGTAAGGAGTGTAACATGAAACATCATACCATGTTGCACAACGTGAACTGGAAAATTCCAGCGAATGGTAAAAATAACTTTGGACAACAAGCCTCCTCTTCTCAGCAACAAGCTTCGAATCACTTATCATCGGATAAAACTGAAATTTTACTAACTACAACTCTACTGAAAATAAAGGCTTATGATGGCACTTATGTAAAACTTAGGGCCCTCTTGGATCAGGGCTCGCAAGTAAACTTAATAACAGAAAATGCCGCTCAGGTATTACGCCTGCCGAGGAAAAGGTTCGCTGCTACCATCTCGGGGGTTGGTTCAGTATCTGGTGATTGCAGGGGTCAACTAAACTTATCTTGTAAATCAATAAACTCTGAATACGACTTCGAAATACAAGCACTTATAATGAAAAAACTTACAAATAACTTACCGAATGCTACTTTCGAAAAATCGAACTGGCCTCATTTGGAAAACTTAAAGCTGGCTGATCCTGACTTCAACATCTCTCGCCCCATCGACTTACTACTGGGTGCCGATGTTTATTCAGATATTATACTCAATGGAGTTTTGAAAGGAAGCTGTCAATCCCCTGTGGCACAACAGACACATCTAGGATGGATCCTATGTGGGAAAATGAAAACGTTTAATTGCCACGTGACCTTGGTGAACTTTGATGAATTAACAAAGTACTGGGAGAGCGAAGAAATACAAAATTCTGAAGATATTTCCAAGGACGACCAGTGTGAACAATTTTATTCGGAAACAGTACAACGTGCTCCCGACGGAAAATATATTGTGAAGATGCCACTCCGCCCTGACCTTAAAGAAAAATTAGGGGAGGGCACGGGGGGTGAGGGCTCGGCGCCGACAGTGGACGAGGAGGCCGCGGCCCGGGAGCGCGAGGCCCGCGCCGCCGCCTCCATCAAGGAGAGGGAGCGGCAGGTGCAGCGAGCCCTCGCCACCAGCCTCCGGGACCGGGACAAGGAGAGACAGTACCACAAGCGAGACGAGGCCGTACAGCACTTTAACGCTCTACTGGCGGATCTAGTCCGGAACCCGGACCTGACGTGGCGCGAAGCCAAGAAACAACTGAAGAAGGACCACCGCTTCGGACTCGCCGAGCTGCTCGCCAAGGAGGACAAGGAGCGTTTATTCAGTCAGCACACGAACAACTTGGCGTCGAAGAGACGAGACAAACTGCGGGGCATCCTGACGGAGCTCGGGGTGTCTTGCACGGCCGCGTGGAAGGAGGTGAAGGAGACGCTCAGCAGCGACCCCACCACCCCCGCCTACGCCAGCGCCACGCAGATGGAGCGCGAGTTCCGGGACTACCAGCGCGACAAGCAGAGCGCCGCCAAGACCGCGCTGCGCCAGCTGCTGCTCGAGACGCGCTCCCTCACGCACCGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACGCGCGCGCAGCTGCCCGCGCACGTGCACGACGCGCTCGACGCCAGGTACGCACCCCCCTCCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACCCCCCCTCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACCCCCCCTCCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACCCCCCTCCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACCCCCCTCCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACCCCCCCTCCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACCCCCCCTCCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACCCCCCCTCCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACCCCCCCTCCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACCCCCCCTCCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACCCCCCCTCCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACCCCCCTCCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACCCCCCCTCCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACCCCCCCTCCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACCCCCCCTCCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACCCCCCCTCCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACCCCCCCTCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACCCCCCTCCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCCAGGTACGCACCCCCCTCCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACCCCCCTCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACCCCCCCTCCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACCCCCCCTCCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGGTACGCACCCCCCCTCCCCCCACTCACAGCACGCGCGCGCAGCTGCGGGACCACGCGCACGTGCACGACGCGCTCGCGCACGACGCCAGATACACGGCGCTCGACCACATCCCCGAGGAGCGGGAGCAGATGATAGCGAGCTACCTGGAGGAGCTGGAGAAGAAGGGCCCCCCGCCTCCCCCCACGGCCACCGAGCCCTCCCGCAGGAACAAGCACTGA
Protein
MDKLELQSTCFENIKTLCTNYRKDSSSRKTEEYLNIRLSSLEEQWRDFEARNALLLLELEDKTIHYFSEDVYNKTKEMYLATKTDLNNRLKYLKQQKHSVNFDLSDISIDYTQDCEDGKSEKIQQLLNKQECNFNAIYHALSKIDIIRTSEKWELEDNFNILKSKWESIDKLHWEIDFQLKGSNDHYYRMYSDIEEKYDELRKQLQSKIWSNAHYQQSTPRMELPDFYGNYSKWISFKDLFLETIHNNPTINKAQKMKHLKTKLKGEAESLVQHLSVCAENYNSCWDILVQRYDNRRLQFSSFFNTMMSLPVIHQPDANNLKKMHDVIKECMNGIANIGLDTATWDPMIVHLMLPKLDSTTLNDYMNEIRDHRELQNLQDFLYFLECKFMAYETAKSTKSVKNTTSEKTSHWKPANNKQPVKKFTYDSKKTYNYHATYGKCPNCNGNHVLMQCAKFINMDTAQRNHTVAKLKLCKNCLYSHNNEECKSAKTCKECNMKHHTMLHNVNWKIPANGKNNFGQQASSSQQQASNHLSSDKTEILLTTTLLKIKAYDGTYVKLRALLDQGSQVNLITENAAQVLRLPRKRFAATISGVGSVSGDCRGQLNLSCKSINSEYDFEIQALIMKKLTNNLPNATFEKSNWPHLENLKLADPDFNISRPIDLLLGADVYSDIILNGVLKGSCQSPVAQQTHLGWILCGKMKTFNCHVTLVNFDELTKYWESEEIQNSEDISKDDQCEQFYSETVQRAPDGKYIVKMPLRPDLKEKLGEGTGGEGSAPTVDEEAAAREREARAAASIKERERQVQRALATSLRDRDKERQYHKRDEAVQHFNALLADLVRNPDLTWREAKKQLKKDHRFGLAELLAKEDKERLFSQHTNNLASKRRDKLRGILTELGVSCTAAWKEVKETLSSDPTTPAYASATQMEREFRDYQRDKQSAAKTALRQLLLETRSLTHRTRAQLRDHAHVHDALAHDARYARARSCPRTCTTRSTPGTHPPPPTHSTRAQLRDHAHVHDALAHDARYAPPLPHSQHARAAAGPRARARRARARRQVRTPPPPTHSTRAQLRDHAHVHDALAHDARYAPPSPHSQHARAAAGPRARARRARARRQVRTPLPPLTARARSCGTTRTCTTRSRTTPGTHPPSPHSQHARAAAGPRARARRARARRQVRTPPPPTHSTRAQLRDHAHVHDALAHDARYAPPLPPLTARARSCGTTRTCTTRSRTTPGTHPPSPHSQHARAAAGPRARARRARARRQVRTPPPPTHSTRAQLRDHAHVHDALAHDARYAPPLPPLTARARSCGTTRTCTTRSRTTPGTHPPPPTHSTRAQLRDHAHVHDALAHDARYAPPLPPLTARARSCGTTRTCTTRSRTTPGTHPPSPHSQHARAAAGPRARARRARARRQVRTPPPPTHSTRAQLRDHAHVHDALAHDASTRAQLRDHAHVHDALAHDARYAPPLPPLTARARSCGTTRTCTTRSRTTPGTHPPSPTHSTRAQLRDHAHVHDALAHDARYAPPSPHSQHARAAAGPRARARRARARRPGTHPPPPTHSTRAQLRDHAHVHDALAHDARYAPPSPTHSTRAQLRDHAHVHDALAHDASTRAQLRDHAHVHDALAHDARYAPPLPPLTARARSCGTTRTCTTRSRTTPGTHPPSPHSQHARAAAGPRARARRARARRQVRTPPPPTHSTRAQLRDHAHVHDALAHDARYTALDHIPEEREQMIASYLEELEKKGPPPPPTATEPSRRNKH

Summary

Uniprot
ProteinModelPortal
PDB
4FQG     E-value=1.40951e-23,     Score=277

Ontologies

GO

Topology

Length:
1757
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00242
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00013
outside
1  -  1757
 
 

Population Genetic Test Statistics

Pi
256.314788
Theta
153.256464
Tajima's D
0.825214
CLR
0.655613
CSRT
0.612019399030049
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号