SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14879
Pre Gene Modal
BGIBMGA007097
Annotation
retrovirus-like_pol_polyprotein_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 3.69
 

Sequence

CDS
ATGAGTCATCATCATGAAAGTAATAACTGTGACGTCAGCAATGCTGACGTCACACTTTTTAAAAACAATACGGAGGTTAATGTTCCGTCATCAGAAGTGGGATCACATGCTGCCTCCGCTCAGCAACAACCTGAAGCTACATCACAAATAGAACCACACCATGGATTAAATACTACAGGCAATGCTGGGAGTTCCTTGGAACAGGAACAGGAACAGCCACAATCAGCATTGCTTAACGCACCGATGAGCAGCGTACCGCCACAATTCATCATGCAGATGATGCATGTGATGCAGCAAATGTCGGAACGCTTAAGTACACCAGCAGAAACTAAGATACGTATAAATGATATTTACCTACCATCATTTGACCCCGATACTAGTGTGGGAGTACGTGAGTGGTGTCAACATATCGATAAAGCCATTGAGACTTATCGACTCAACGACTTTGACATACGCATGAAAGTTGGCAGCCTCCTAAAGGGAAGAGCGAAGATGTGGGTTGACGATTGGATGGTCACTGCAGCTTCGTGGGCTGAGCTGAGCAACAATCTTATCACGACATTCGAGCCAGAAAATCGCTATTCTCGAGACATAGCTCGATTTAGAGAACATATGTACGACTCTTCAAAGGACATCTCGGAGTTCTTGTCACGAGCTTGGGTCTTGTGGAGGAGGATCACCAAAGACAAACTACCTAATGAAGATGCAGTTGAAGCAGTTATTGGTTGCGTGAATGACGAGAAACTTAGGATCGAGCTACTGAACACAAGAGCCACAACAGTACCAGAATTGATATCTGTTGCATCATCAGTAAGAGCCATGAAGCGTTTTCACCAGGGCTCAAATAAGCTGAGTACAAATAAGCGTCCCCGTTTTTTGAATTCTACTTCATCAAATTCATCTTGCCATATCTGTAAAAGAACTAATCACACCACCAACGAATGCTACTACAAAATGGTTACCGAATCAAAGCCCGAACAAAGAAACAAAACAACAACTGAGACAACGAAGGAAGTAACCTCCTACCAGAACGATAAAATAACAATCTGTTCATTCTGCAAAATACCAGGACACAGTTTTGAAACATGCTTCAAACGTGAACGAGCATTGACATCAAACGTAAATTACGTTGCTGGATCAAAACTAGCTCCGATTCAGGTGAAGTTTGGATCAAAGAGTTTTCAGGCAATCTTTGATAGTGGCGCAGAATGCTCACTTATGCGGGAATCCGTAGCAGCTCAAATACCCGGAAAAAGACTACAAACGGCAGATTACTTGAAAGGAATTGGACAATTTCCTGTACTATCAATAGCTACACTCGTAACGGTAGGTGTCATCGATAACATCAACGTTGAATTACAGTTTCACATAGTGGCAGATTACGAGATGACTACAGATATTTTAGTGGGTATGAACTTGATAAACAATACGAACCTAACTATGACGATCACTTCGGGCGGGACGAGGCTAGCACGTCAGCCACATGTTAATCAAGTTCAGTGTATAAATCCAATTTTCGATAAACTGGATTGTGATCTCACAAATGAAGAAGATATCGCAAAATTACGCACCCTTCTAAACAAATATCAGCACCTGTTTATCAGAGGGTATCCAACAACTCGTGTCAAGACAGGTGAACTGGAAATCCGCCTGAAGAATCCAAACAAATATGTAGAACGAAGACCTTACAGGCTCAGTCCAATCGAACGAGAAAGGGTGCGAGCCATTGTGAAAGAGTTGATGGAGCATGGCATTGTACGCGAAAGCAAGTCTCCATACTCCAGTCCCATCATCTTGGTGAAGAAGAAGAATGGTGACGATCGCATGTGCGTGGATTTCAGAGAACTTAACTCTAATACCTTACGGGACCATTACCCGCTGCCACTAATTTCAGACCAAATTGACCAATTGGCCAAGGGGCAATTCTTTACAACCTTTGACATGGCCGCAGGGTTTCACCAAATACCTATTGCAGAATCATCAATTGAAAAGACAGCCTTTGTCACACCGGATGGACTGTATGAATATACGACTATGCCATTTGGATTGAGTAATGCATGTTCAGTCTATCAACGATGCATCAACAGAGCTCTGAGCTCGTTAATAGGGAATGCAGCTCAAGTCTACGTCGATGACGTATTAAGCAGATGTGAAAATATCGCAGAAGGGCTGTCAAACATAGAACGTATTCTAATAGCACTACAAGATGCGGGTTTTTCCATTAATGCTGATAAATGCAGTTTTTTTAAGCGCTCCATCGAATATTTGGGTAACGTAGTATCTAATGGACAAGTCTGGCCAAGCCCACGGAAAATAGATGCTCTGGTAAAATCGCCGGTACCAACAACACCCAGACAAGAGGAAGCACCTATTCAATTGTACACAGATGCAAGTAGTTTGGGATTCGGAGCAGTACTGGTACAAGTAATTGCGGGACGACAACATGCAGTTGCCTTTATGAGCACGAGAACTACTGAAACAGAAAGTCGCTATCACTCTTATGAATTAGAGACCTTGGCAGTAGTCCGAGCGATAAAACACTTTCGGCAGTATCTTTATGGACGTAAGTTTACAGTTATCACAGACTGTAATGCACTAAAAGCATCCAAACACAAAAAGGACTTACTCCCTAGAATCCACCGTTGGTGGGCATTTTTACAAAACTATAATTTTGAGGTTGAATACCGCAAGGGTCAACAGCTTCAACACGCAGACTACTTCAGTGGGAACCCAGTCGAACTCACAGTGAATATAATGACCAGAGATCTAGACTGGCTGAAAATTGAACAGCGACGTGATGAAACACTACGAGCTATAATGGATGGTATGAATAATAACAATCCAAGTAACGGCTATATGCTAGAAAACAATGTCCTCAAGCATATCGTGCAAGATCCAACCTTCGGACACCGATACTGCACAGTGGTACCCAGGTCCTTTCAGTGGAGTTTAATAAACTCCTTCCACACCGCACTGAAGCACCCTGGCTGGGAAAAGACGTTGCAGAAAATTAAGGACAGCCACTGGTTTGACAACATGAGCACGAAGAAACCGTCTGCTGCTTTTCAAGTAATACACATGGATATAACAGGCAAGATGGGAACATCCAACGACCAACAGTATGTGATTATCACCATAGATGCTTTTACGAAATACGTGCTATTCTATTATGCAACTAACAAAAATCCACCCAGCACATTAGCTGCCTTAAAGCGTACGGTTCATCTATTCGGTACTCCTGTCCAAATAATAGTCGACGGTGGAAGAGAGTTCCTCGGTGAATTCAAGACCTACTGCGATAGGGTAGGTATTGACATTCATGCTATAGCACCAGGAGTCAGCCGAGCAAATGGACAAGTAGAACGCGTCGTAGCTACACTAAAAAATGCTCTTACTATGATCAAGAATTACGAAACAGAAGAGTGGCACACAACGATTGCAGAACTTCAGCTAGCAATAAATTGCACTCCGCATCGTGTGACAGGCGTAGCTCCACTTACATTACTCACTCAGCGAAAGCATTGTGTTCCTCCAGAGCTACTTAAATTAGTAAATATTGACGAGCAGACTATTGATATTGAAGCACTCACTAACCATGTTCAACACAAGATGTCACAAAATGCAGAACAGGACAGGCAACGTTTCAATTCAAAAAAAGCTAGGATCCATCATTTCCAGCGTGGTGATTATGTGCTCATAAAAAATAATCCTCGTAATCAAACTTCGTTGGATCTCAAATTCAGCGAGCCATATGAGATAACAAGAATCCTGGACAACGACCGCTATTTAGTAAAAAAGGTGGTTGGTTCAGGGCGTTCAAGAAAAGTAGCTCATCATCAACTCCGTCGGGCACCGCAACCTGGAGACCAGATAGCCGTATCGGCGGAAGAAGACGACCCTCCAGCATCAGCCGATGAACCTATATGA
Protein
MSHHHESNNCDVSNADVTLFKNNTEVNVPSSEVGSHAASAQQQPEATSQIEPHHGLNTTGNAGSSLEQEQEQPQSALLNAPMSSVPPQFIMQMMHVMQQMSERLSTPAETKIRINDIYLPSFDPDTSVGVREWCQHIDKAIETYRLNDFDIRMKVGSLLKGRAKMWVDDWMVTAASWAELSNNLITTFEPENRYSRDIARFREHMYDSSKDISEFLSRAWVLWRRITKDKLPNEDAVEAVIGCVNDEKLRIELLNTRATTVPELISVASSVRAMKRFHQGSNKLSTNKRPRFLNSTSSNSSCHICKRTNHTTNECYYKMVTESKPEQRNKTTTETTKEVTSYQNDKITICSFCKIPGHSFETCFKRERALTSNVNYVAGSKLAPIQVKFGSKSFQAIFDSGAECSLMRESVAAQIPGKRLQTADYLKGIGQFPVLSIATLVTVGVIDNINVELQFHIVADYEMTTDILVGMNLINNTNLTMTITSGGTRLARQPHVNQVQCINPIFDKLDCDLTNEEDIAKLRTLLNKYQHLFIRGYPTTRVKTGELEIRLKNPNKYVERRPYRLSPIERERVRAIVKELMEHGIVRESKSPYSSPIILVKKKNGDDRMCVDFRELNSNTLRDHYPLPLISDQIDQLAKGQFFTTFDMAAGFHQIPIAESSIEKTAFVTPDGLYEYTTMPFGLSNACSVYQRCINRALSSLIGNAAQVYVDDVLSRCENIAEGLSNIERILIALQDAGFSINADKCSFFKRSIEYLGNVVSNGQVWPSPRKIDALVKSPVPTTPRQEEAPIQLYTDASSLGFGAVLVQVIAGRQHAVAFMSTRTTETESRYHSYELETLAVVRAIKHFRQYLYGRKFTVITDCNALKASKHKKDLLPRIHRWWAFLQNYNFEVEYRKGQQLQHADYFSGNPVELTVNIMTRDLDWLKIEQRRDETLRAIMDGMNNNNPSNGYMLENNVLKHIVQDPTFGHRYCTVVPRSFQWSLINSFHTALKHPGWEKTLQKIKDSHWFDNMSTKKPSAAFQVIHMDITGKMGTSNDQQYVIITIDAFTKYVLFYYATNKNPPSTLAALKRTVHLFGTPVQIIVDGGREFLGEFKTYCDRVGIDIHAIAPGVSRANGQVERVVATLKNALTMIKNYETEEWHTTIAELQLAINCTPHRVTGVAPLTLLTQRKHCVPPELLKLVNIDEQTIDIEALTNHVQHKMSQNAEQDRQRFNSKKARIHHFQRGDYVLIKNNPRNQTSLDLKFSEPYEITRILDNDRYLVKKVVGSGRSRKVAHHQLRRAPQPGDQIAVSAEEDDPPASADEPI

Summary

Pfam
PF00098   zf-CCHC        + More
PF00078   RVT_1
PF00665   rve
PF17921   Integrase_H2C2
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
PF00077   RVP
PF03732   Retrotrans_gag
PF02037   SAP
Interpro
IPR000477   RT_dom        + More
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR041373   RT_RNaseH       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR018061   Retropepsins       
IPR005162   Retrotrans_gag_dom       
IPR003034   SAP_dom       
IPR036361   SAP_dom_sf       
SUPFAM
SSF57756   SSF57756        + More
SSF53098   SSF53098       
SSF50630   SSF50630       
SSF68906   SSF68906       
Gene 3D
PDB
4OL8     E-value=7.14615e-52,     Score=520

Ontologies

Topology

Length:
1308
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0636699999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00207
outside
1  -  1308
 
 

Population Genetic Test Statistics

Pi
236.865921
Theta
220.340328
Tajima's D
1.456821
CLR
132.609357
CSRT
0.778111094445278
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号