SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14867
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Full name
Sodium/hydrogen exchanger      
Location in the cell
Nuclear   Reliability : 3.608
 

Sequence

CDS
ATGGAATTACTTCTACGTAAACTCGAAGAGAAATTAGATAAACAAGCCGACCAGATAACAAAGGCGGTAACTAAGAACGTCACAGAAGCTATAGACGAGAAAATAAATGCGATAATTGAAGAAAATAAACTCCTCACAAACAAAGTATCCGAACTAGAGTTGAAAATTAAATCCTTAGAAAGAGAGAAACGAAAAAACAACCTCGTCTTCTTCGGAGTAGACGAAATAGGAAAATCCGAGCGAGAATTAGTAGATTATATAAAAGATACCATAGAAGATCTAGGAGTGCAAATGAACAGCCAAGAGATTAGTAACATATATAGAATCGGAAGAAAGACGGAAAACAAAAACCGACCAGTCGTAATTTCTTTAACAACCCTGTGGAAGAAGCATCTTGTACTCAAGAACAAGTCTAATCTCCCGTCAAATATATATGTTAAAGAGGATTACTCCAAGGAAACTCTGGAAAGGCGCAAAAAACTACAATCCCAAGTGGAAGAAGAAAAAAAGAAAGAAAACCGGAAACAAATAGAAACGGCTAAAACAATTAGACTTAAGCAAAAACAACGAACAAATTGTCTCCCACAACGGCTGGTCTCCGCGGGAGCACTAGACCAAAACCCTCCAGCAAAAAGAAACGAAACATTCCACATTGCAACACTCAACACAAGAACTCTGCGAACACAGGAAAGCCTACTTGAACTGGACAAGGCGTTACAAAATATAAAACTGGATATCCTGGGAATATGTGAAATGAGAAGGCTTGATGAAAAAATAACTGAACGAAACAACTACATATTATATCAGAAAGGTGAAACAGCAGGCCAAAGAGGTGTGGGCTTCTTAATTAAAAAATCATTGAAGAACTTTATACAAGAACTGATAGGCATTTCAGACAGAATAGCAATACTCAACATTAACTTACCAAGATACAAAAAACCCTGGACAATTATACAAGCATACGCACCCACAGAATTAGCATTGGAAAGTGAAAGAGAGGGATTTTACTGCACACTATCTGATATTATAAAAAAATATTATAAGAACTTTCTCATAGTCATGGGTGACTTTAATGCACAAGTTGGCTGTAGAGAACCCGGAGAAGAACTGATAATGGGCAAACATGGATTTGGAAAGAGGAGTGCAAACGGACATCGACTAATTGAATTTTTACTACAAAACAACTTAACAATACTAAATTCGCTCTACAAAAAAAAACCCAAAACCAAGTGGACTTGGATATCACCTGATGGAAAATATAAGAATGAAATCGATTTCATAATAACTAACAAACCAAAGTTTTTCCAAGATACACACATTATTCAAAACTTAAATTTTAATACGAACCACCGTATGGTACGTTGCCGTTTAGAAAAGCATCAACCAAAAAGAAGTAGAAATAATATTAAAAATAAATTGACATTAGAACAACACAAAGAAAAAATAGATTCATCGTCCATCAACACACTGAAAGAAATAGTAAACTCGAACAGAAGTGTCACAGAAAAATATGATCTCATGGTCACACAACTGTCAAAATTGAGGAAAGTAAATGCAACAAAAGATGTGAAGTTTGGTGCGAAGACAATGGAGCTCCTAGAAGAACGAAAAGTACTTATAACAGACAAATCAAAAACTGAAGAAAACCGTAAGTTAATATCTAAACTGAGCAAAGAGATTCGGGAAAGCATAAGAAAGGATAGGAAATTAAGAAGAACGAAAAAATTAGAAGATGAAATTCTAAGAACAGGGGGAACAAGAAAAGCTTTTAAGGAATTAAGAGAACATGGAGTGGAATGGATACCAAAACTAAAAAGCAACAGCTCCAAACAAGCAACAAATCGCAGAAAAATTCAGAGTCTTGCTACAGATTACTATCGAACTCTTTACTCGGACAATGACACCGACCGAGAAAAGACCGCCGTTAACGATCCTAGTACGAATAATAAAAAAGTACCACCAGTACTCTTGCAAGAAGTACAGAAAGCCATCATGTCTCAGAAGCCAGAAAAATCTCCAGGACCCGACAGTATATCAAATGAGCTGATTAGAGGTAACGAAGAAGAAATAAGCCCAATCCTAACCAAGCTATTCAATGATATTGTAACAACAGGTGTCATCCCAAAACAATGGAATGAGTCACATATCATCCTCCTCCATAAGAAAGGAGATAAAGATGATATTGGCAACTACAGACCAATCAGTCTAATATCAAATGTGTACAAAGTCTTCGCAAAAGTAATTCTAGAAAGAATAACAAGGGCTTTAGACGAAAACCAACCGATCGAGCAGGCAGGATTTAGAAAGAACTACAGCACTATAGACCACATCCACACAATCAAACAAGTTTTGGAAAAATACAATGAATACCAGAAGACTTTGTATATCTGCTTTATAGACTACTCCAAAGCATTTGACAGTATAAAACACAAATTTATTTGGCTGAGTCTAAAACAACAAGGAGTGGACGATATATATATAGAACTAATCAAATCCATCTACAAAAAAAGTAAAAGCAGTATTAAATTAGAGTCAAAAGGAGACCCCTTTCCAATAAACAGAGGCGTAAGACAAGGTGACCCATTATCTCCCAAGCTGTTTAATGCAGTACTGGAATGCACATTTAGAAGATTAAACTGGGATAACTATGGTATTATAATCAATGGAAGTCGCCTCAATCATTTGAGATTTGCAGATGATATTATCTTGCTAGAAGAAGATCCTAAGAAACTTGAACACATGATTAAAGAAATAGTAGAAAAAAGCAGAGAAGTAGGGCTAGAAATTAATGCAGATAAAACGAAACTAATGACGAACTCAACAGAAAGGAACATAGAGGTAAACGGAACCAAGTTCGAATATGTGAAGGAATTCGTTTACCTAGGACAAATTATATCTTCTGAAGACTCCATGTCCAAGGAAATAAACAAAAGAATAGCATGCGGTTGGAAAAAATACTGGTCCTTGAAAGAGATAATGAAGAATAAAGATCTAGGTATACATATCAAGAGAAAGACTTTCAACACTTGTATTCTCCCTTGCATGACTTACGGATGTGAGACATGGACACTAACTGACAAACATAGAGAAAAACTTGCTAAAACAGAGAGAGCAATGGAAAGAAGCATGTTGAGTATCAGACTTAGTGACAGGATTCGAAATTGGGAAATAAGAAGGAAGACAAAAGTAACGGATATAATAACTCGTATAGAAAATCTTAAATGGAGTTGGACAGGACATATGCTACGTTGCAAAAAAAACAAGTGGAGCAAACAAGTTACTTTATGGTATCCAAGAGGGGACACCAGAAGACAGGGGCGACCAAAAACGAGATGGAGCGATGATATACGCCTAACCCTAGGACCATACTGGACCAGAGTTGCAGAGGACCGAGCCCAATGGAGAGAGCTGGAGGAGGCCTATGCCACGAGGCACGCCGAACTCCGAGATATACTATAA
Protein
MELLLRKLEEKLDKQADQITKAVTKNVTEAIDEKINAIIEENKLLTNKVSELELKIKSLEREKRKNNLVFFGVDEIGKSERELVDYIKDTIEDLGVQMNSQEISNIYRIGRKTENKNRPVVISLTTLWKKHLVLKNKSNLPSNIYVKEDYSKETLERRKKLQSQVEEEKKKENRKQIETAKTIRLKQKQRTNCLPQRLVSAGALDQNPPAKRNETFHIATLNTRTLRTQESLLELDKALQNIKLDILGICEMRRLDEKITERNNYILYQKGETAGQRGVGFLIKKSLKNFIQELIGISDRIAILNINLPRYKKPWTIIQAYAPTELALESEREGFYCTLSDIIKKYYKNFLIVMGDFNAQVGCREPGEELIMGKHGFGKRSANGHRLIEFLLQNNLTILNSLYKKKPKTKWTWISPDGKYKNEIDFIITNKPKFFQDTHIIQNLNFNTNHRMVRCRLEKHQPKRSRNNIKNKLTLEQHKEKIDSSSINTLKEIVNSNRSVTEKYDLMVTQLSKLRKVNATKDVKFGAKTMELLEERKVLITDKSKTEENRKLISKLSKEIRESIRKDRKLRRTKKLEDEILRTGGTRKAFKELREHGVEWIPKLKSNSSKQATNRRKIQSLATDYYRTLYSDNDTDREKTAVNDPSTNNKKVPPVLLQEVQKAIMSQKPEKSPGPDSISNELIRGNEEEISPILTKLFNDIVTTGVIPKQWNESHIILLHKKGDKDDIGNYRPISLISNVYKVFAKVILERITRALDENQPIEQAGFRKNYSTIDHIHTIKQVLEKYNEYQKTLYICFIDYSKAFDSIKHKFIWLSLKQQGVDDIYIELIKSIYKKSKSSIKLESKGDPFPINRGVRQGDPLSPKLFNAVLECTFRRLNWDNYGIIINGSRLNHLRFADDIILLEEDPKKLEHMIKEIVEKSREVGLEINADKTKLMTNSTERNIEVNGTKFEYVKEFVYLGQIISSEDSMSKEINKRIACGWKKYWSLKEIMKNKDLGIHIKRKTFNTCILPCMTYGCETWTLTDKHREKLAKTERAMERSMLSIRLSDRIRNWEIRRKTKVTDIITRIENLKWSWTGHMLRCKKNKWSKQVTLWYPRGDTRRQGRPKTRWSDDIRLTLGPYWTRVAEDRAQWRELEEAYATRHAELRDIL

Summary

Similarity
Belongs to the monovalent cation:proton antiporter 1 (CPA1) transporter (TC 2.A.36) family.
Feature
chain  Sodium/hydrogen exchanger
EMBL
FJ265564    ADI61832.1    FJ265561    ADI61829.1    ODYU01008249    SOQ51673.1    + More
FJ265562    ADI61830.1    FJ265563    ADI61831.1    GBBI01004876    JAC13836.1    KZ149907    PZC78256.1    ODYU01004088    SOQ43598.1    GBGD01000380    JAC88509.1    FJ265542    ADI61810.1    FJ265549    ADI61817.1    FJ265550    ADI61818.1    FJ265551    ADI61819.1    FJ265545    ADI61813.1    JARK01001655    EYB84321.1    JARK01001676    JARK01001446    JARK01001433    EYB83199.1    EYC01126.1    EYC02928.1    JARK01001565    EYB89683.1    JARK01001337    EYC34625.1    DS268591    EFO92565.1    DS268444    EFP01729.1    JARK01000173    EYC41342.1    JARK01000388    EYC37469.1    JARK01001370    EYC16150.1    JARK01001348    EYC25048.1    EYC25050.1    JARK01001473    EYB97806.1    JARK01001736    JARK01001462    JARK01001379    JARK01001338    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    EYC25046.1    EYC25049.1    JARK01001353    EYC22263.1    DS268655    EFO97114.1    JARK01001626    EYB85833.1    DS268505    EFP13372.1    JARK01001340    EYC30828.1    JARK01001621    EYB86109.1    JARK01000460    EYC36749.1    EYC16376.1    AF054983    AAC72298.1    JARK01001500    JARK01001343    EYB95040.1    EYC28825.1    JARK01001354    EYC21986.1    GL379822    EGT48339.1    JARK01001711    EYB81734.1    JARK01001700    JARK01001393    EYB82228.1    EYC10181.1    JARK01001543    EYB91356.1    JARK01001730    EYB81048.1    DS268752    EFP01106.1    JARK01001438    EYC02111.1    JARK01001395    EYC09729.1    EYC09730.1    JARK01001475    EYB97550.1    JARK01001568    EYB89432.1    JARK01001505    EYB94618.1    EYB94617.1    EYC33297.1    JARK01000063    EYC44387.1    JARK01001531    EYB92324.1    JARK01001581    EYB88505.1    JARK01001628    JARK01001583    JARK01001528    JARK01001506    JARK01001470    JARK01001467    JARK01001463    JARK01001457    JARK01001432    JARK01001420    JARK01001403    JARK01001371    JARK01001369    JARK01001360    JARK01001349    JARK01000603    JARK01000080    EYB85741.1    EYB88438.1    EYB92544.1    EYB94540.1    EYB98080.1    EYB98468.1    EYB98899.1    EYB99568.1    EYC03088.1    EYC05014.1    EYC08153.1    EYC15852.1    EYC16408.1    EYC19456.1    EYC22445.1    EYC24734.1    EYC24778.1    EYC24866.1    EYC33488.1    EYC35672.1    EYC43798.1    JARK01001344    EYC28216.1    JARK01001497    EYB95322.1    JARK01001389    EYC10874.1    EYC25145.1    JARK01001401    EYC08686.1    JARK01000008    EYC46079.1    JARK01000302    EYC38674.1    JARK01001582    EYB88498.1    EYC30744.1    QFQQ01000179    PZR20596.1    JARK01001372    EYC15614.1    JARK01000343    EYC38099.1    JARK01001459    EYB99276.1    EYC03125.1    JARK01001421    EYC04912.1    EYB99275.1    JARK01001346    EYC26445.1    JARK01000109    EYC42952.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF00069   Pkinase
PF00201   UDPGT
PF00999   Na_H_Exchanger
PF10328   7TM_GPCR_Srx
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR029052   Metallo-depent_PP-like       
IPR000719   Prot_kinase_dom       
IPR017441   Protein_kinase_ATP_BS       
IPR008271   Ser/Thr_kinase_AS       
IPR011009   Kinase-like_dom_sf       
IPR002213   UDP_glucos_trans       
IPR001507   ZP_dom       
IPR018422   Cation/H_exchanger_CPA1       
IPR006153   Cation/H_exchanger       
IPR004709   NaH_exchanger       
IPR019430   7TM_GPCR_serpentine_rcpt_Srx       
IPR017452   GPCR_Rhodpsn_7TM       
SUPFAM
SSF56219   SSF56219        + More
SSF56112   SSF56112       
Gene 3D

Ontologies

Topology

Length:
1152
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0005
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1152
 
 

Population Genetic Test Statistics

Pi
10.348894
Theta
30.16349
Tajima's D
0.653805
CLR
34.250886
CSRT
0.56157192140393
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号