SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14855
Pre Gene Modal
BGIBMGA012158
Annotation
PREDICTED:_AT-rich_interactive_domain-containing_protein_5B-like_[Bombyx_mori]
Transcription factor
Location in the cell
Nuclear   Reliability : 3.599
 

Sequence

CDS
ATGAAACGGGCCCGAACGACGAAGCACACGAATATTGAGGAAGCTTTGCTGAAGTGGTTCAAATATCAGAGGTCTAATAATGTGCCAATAAACGGACCGATTCTACAAGAAAAAGCTAACCATTTTGCTAAATGTTTTGGCGAAGATTTTGTTTGCTCGTCTAGTTGGATCCAACGTTTTCGGGCTCGGCACGGTATTGTCGGCGGGAAAATGAGTCGTGAAGCTGCTAGTGTTGATAAGGATACTGTAGAAGAATGGAAAACGCAAAAGCGGCCTACATTATTTGAAGGCTACGGACCAGATGAAGTTTTTAACGCAGCCGAGACTGGACTTTTTTACAATATGACACCAGACAAGACGTTAAAGTTCAAAGGAGAGAATTGTTCGGGAGGAAAAATGTCTAAGACAAGATTAACGATCATGGTCGCAGCAAATATGACAGGATCATGTAAAAGGAAGCTTTTAGTTATTGGCGAATCTAAGAAACCAAAATGCTTTAAAAACACACACTCACTACCGGTAACGTATGAAAACAATGTGCAGTCATGGATGACATCGGACATTTTTGAGAGATGGTTAAGAAACTGGGACGCTGAATTGAAAGGAAACAAACAGAAAGTTCTACTTTTGGTTGATAACTGTCCTGCTCATCCGGCTGTTACTAATCTAAAATGCATTAAACTTGTGTTCTTACCGCCAAATGTTACATCTGTATTGCAACCAATGGAGCAAGGTGTAATAAGGTGTTTAAAATCTCACTATAGAAGACTGCAAGTGTTAAAGTTAATACAAAACCTTTACAGTGGCGACCAAAAAAGCTTTACGATTCTTGATGCCATCTTGATGATATCAGAAGCATGGAAAAATGTTTCACAAAACACTATAGCTAACTGCTTTAAACATGCTGGTTTTAAAGACCTCTTAACAACAGCCTCAGATGATGTGACTGATGATGATGGAGAGGACAATATTTCTCTTGCTCAATTATCCCAAAATTTACGACCTGCTTTATCTACTACTGAAGCAGCAGAGTTTATTGATGTAGATAACTCTATTGCAATTTGCGCACGAGCTACGGAAGATGATATTGTACGAGATGTTCAAGAGGAGGATGACGAACAGGAAGATTCTGAAGAAAAATTTACTGTACCAACTTTGAATGATGGTATCAATGCGGACACGTTCGAATACCCGGAGCTCGAGGGTCACGAGTTCGTCTGCAACCACCTCGCTCCGCGGCTGAAAGGCAGGCCGAGGGGACGGCGACGGCGCGCAGCCAGGTCCAGGTCGCACTCGCCCTCGCCCTCCTCCCGGTCCAGCGACTCGGACCAGCAGAGCGGCAACCCTGAGCCCGATACGCCGCGGCGCCTCTCTCTGCGGAACGGCGCCGATCGGAACAGCGACGACGAGAACGAGTACCGGCGGCAGGAGACGCCCGAGGACCGGGCCTTCGTCAACCAGCTCAGGCAGTTCTACAGGGACAGGAACGAGACCTTCAAGGAGCACGCCCTCAAAGATGTGACGCCTTTGGCCCTGTACCGCGGGGTGTGCTCGCGGGGCGGCTACCGGGCCGTGTGCCGCCGCGAGCTGTGGCCGCGCCTCCTGCCGCGCCCGGCGCTCGCCCGACGGTACTATGAGAGGTACCTCCTCCCCTTCGAGACCTACGAGCGGAAACTGAACGGCAGCACCGAAAACATCCCGACCATCGAGGTAGCCGACTCCCCACAGCACTCGCCCAGCAAGAAGCCGCTGGACAGGACGAGGGTCATCGATGTGGACGACGAAACGGGCGAGGTCAAGGACGTGCCCGACTGCCCCGCCACCAGCCAGCCCGCCGAGGTGCTCAACCGGGAGTTCCTGGACTCGCTGGACGCGGACAGGCGCGCCGCCAAGATCAACGTCGTGCCCGTCGAGAAGCTGAAGGACGAGAAATGCGCCGTCATCAACAACAACGTGCACCTGCCGAACACATCATCGAACGCTGAACAGACGATAGTGAGGACGAACCCTGTGACCACCGAGCCGGTTGTCAACGGGCATGCGGACAATGGACCGCAGAAGACGGTCCGTCCCCTCGGTAAGAGTTCCCTCCGCGCCGTCCGAGTGAAGGCGACGCGACCTCACGCGCAGCCCGCCAGTGCACCTCCGTCGCTCCTGAGGGGATCCCCGCCCGCCGCCGGACTCAACAACTTCGGCATCCACCGGCCCCCGCCCGCCCCGCGCCGCGCCCCTCGCAGCGACGACGAGATCGTGGAGGTCCCGTACAAGCCCAAGAGTCCCGAGATCATAGACCTGGACGAGTACCCGGAGAGTCCTCAGACCTTCAAGAAGAAGAAGCTGGAGATACTCAAGGAGCGAGGACTGGAGGTGACGGTGCTGCCCGCGGGCCCCTGGCCGGTGCTGGCGCCCGTCGCGGCCGTGCAGCACCTCGGCTACCCGCGGCCCGCGCAGCTGTACCAGGTGTTCGGCGCGGGCCCGCCCAAGGTCATCCAGTCCACCTCGCCCTTCGGCTGCGACGGGCCCCAGAAGACGGTCTACGGGAACCCTAAGGACCCGTTCATGCCGCCGCCGCACGTGCTGCAGGGCGCGCCCGTGAGGCCGCAGCGAGCCCCCCCCGCCCCCCACGAGCCGCCGCACGTGCTCGACCTCACGTGCAAGCTGGGGTCGCCCGCGGGCAGCGCCGTCCGCGTCGACTCTGATCTGGAGATCACGCTGCTTGAGGACACGAACGCCTCGCAGAAGAGGCCGGCGCTCCGCCCCCCGTGCGGCGCGGACGGGGCGGTCGGCTACAGCTACAAGGACCCGTACGCCGCCTTCTACAACAGCCTGGCGGGGTCCGTGGACCAAAGGCAGCTGGCCATGTACCGAGAGCTGGTCTCCACGCAGTTCCGCGGCTACGGGCTGGCGGGCCTCGCGCCCGGACACGTGCCCACCAGCAAGTGA
Protein
MKRARTTKHTNIEEALLKWFKYQRSNNVPINGPILQEKANHFAKCFGEDFVCSSSWIQRFRARHGIVGGKMSREAASVDKDTVEEWKTQKRPTLFEGYGPDEVFNAAETGLFYNMTPDKTLKFKGENCSGGKMSKTRLTIMVAANMTGSCKRKLLVIGESKKPKCFKNTHSLPVTYENNVQSWMTSDIFERWLRNWDAELKGNKQKVLLLVDNCPAHPAVTNLKCIKLVFLPPNVTSVLQPMEQGVIRCLKSHYRRLQVLKLIQNLYSGDQKSFTILDAILMISEAWKNVSQNTIANCFKHAGFKDLLTTASDDVTDDDGEDNISLAQLSQNLRPALSTTEAAEFIDVDNSIAICARATEDDIVRDVQEEDDEQEDSEEKFTVPTLNDGINADTFEYPELEGHEFVCNHLAPRLKGRPRGRRRRAARSRSHSPSPSSRSSDSDQQSGNPEPDTPRRLSLRNGADRNSDDENEYRRQETPEDRAFVNQLRQFYRDRNETFKEHALKDVTPLALYRGVCSRGGYRAVCRRELWPRLLPRPALARRYYERYLLPFETYERKLNGSTENIPTIEVADSPQHSPSKKPLDRTRVIDVDDETGEVKDVPDCPATSQPAEVLNREFLDSLDADRRAAKINVVPVEKLKDEKCAVINNNVHLPNTSSNAEQTIVRTNPVTTEPVVNGHADNGPQKTVRPLGKSSLRAVRVKATRPHAQPASAPPSLLRGSPPAAGLNNFGIHRPPPAPRRAPRSDDEIVEVPYKPKSPEIIDLDEYPESPQTFKKKKLEILKERGLEVTVLPAGPWPVLAPVAAVQHLGYPRPAQLYQVFGAGPPKVIQSTSPFGCDGPQKTVYGNPKDPFMPPPHVLQGAPVRPQRAPPAPHEPPHVLDLTCKLGSPAGSAVRVDSDLEITLLEDTNASQKRPALRPPCGADGAVGYSYKDPYAAFYNSLAGSVDQRQLAMYRELVSTQFRGYGLAGLAPGHVPTSK

Summary

Pfam
PF01388   ARID        + More
PF03221   HTH_Tnp_Tc5
PF03184   DDE_1
Interpro
IPR006600   HTH_CenpB_DNA-bd_dom        + More
IPR036431   ARID_dom_sf       
IPR009057   Homeobox-like_sf       
IPR001606   ARID_dom       
IPR004875   DDE_SF_endonuclease_dom       
SUPFAM
SSF46774   SSF46774        + More
SSF46689   SSF46689       
Gene 3D
PDB
1HLV     E-value=0.000133614,     Score=112

Ontologies

Topology

Subcellular location
Nucleus  
Length:
980
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01752
Exp number, first 60 AAs:
0.00052
Total prob of N-in:
0.00059
outside
1  -  980
 
 

Population Genetic Test Statistics

Pi
243.521997
Theta
195.86455
Tajima's D
1.287024
CLR
0.409414
CSRT
0.739713014349282
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号