SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14833
Annotation
PREDICTED:_craniofacial_development_protein_2-like_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 3.57
 

Sequence

CDS
ATGGATAAAAATATGGAAATATTATGGTCAAAATTAGAAGATAAGCTAAATCAACAAACTCTAATAATAACTAATACAGTCACAATAAATGTTACGGAGGTGTTAAATGAAAAATTGGAATCGCTTACTGAAGAAAATAAAAACCTCAAATTAAAAATTTCTGAATTAGAACAAAAGCTACAGTATTTGGATAAAGATAAACGAAAGAATAATTTAGTCTTTTTCGGTGTCGAAGAAAATGGAAAAAGAGAAATAGATCTTGTAGAATACATAAAGAAGATTATCGTAGAAGCAGGCACCCCTCTGGACTGTCAAGAAGTAAGTAATATTTATAGAATCGAATCCCGCCATCGGACTAGCACCTTACACATCGTTACATATAATACACTTTCACTACGATCAGAAGAAAAATTGACAGAACTTGTGTTCGCATTAGATAATATAAACTGGTCTATCGTTGGTTTAAGTGAAGTGAGACGTATAGGAGAAAACATAGAAGACTTCGGTGAATTTACTTTTTACCACAACGGTTACACACCGGGCCAATACGGTGTAGGTTTCTTAGTGAAAAAAGAATTAAAAGAATGTATAGATGAATTCATAGGCATATCAGAGCGAATCATTTTATTAAATTTAAAGTTACCACCTTTAGACGAGATGTGGTCCATAGTGCAAATCTACTCCCCGACAGAGCAAGCGACCAGCACAGAAATCGACTCTTTCTATTTGCAGCTAACAGAAACAATAAAAACTTATTCATGCAGCAACCTCATAGTGATGGGAGACTTTAATGCGCGAACAGGATACAGAGTAGAGGGTGAAGATATAGTGCTGGGGCCATACAGTACAGGAAAAAGGACACGAAACGGCGAGAAATTGATTCATTTAGCATACGAGAATAATCTGAAAATATTGAACAGCTATTATAAAAATCGACCAAGGAATAGGTGGACGTGGACATCTCCAGACGGTCGTTACAAAAATGAGATAGATTACATTCTCTCGAATCGAAGTACAGCTTTTCAAGATTGTCGAGTTATAAATAATTTAAACTTTAACAGTAACCATAGACCTGTCAGAGCCAAGCTAAAACTAAACACCTCTAAGAAAAGACCTTTTAAAGCAAATCTAACAAACAAAACCACAAGCCTGAATACAAAACAAAGCAGCTACTAG
Protein
MDKNMEILWSKLEDKLNQQTLIITNTVTINVTEVLNEKLESLTEENKNLKLKISELEQKLQYLDKDKRKNNLVFFGVEENGKREIDLVEYIKKIIVEAGTPLDCQEVSNIYRIESRHRTSTLHIVTYNTLSLRSEEKLTELVFALDNINWSIVGLSEVRRIGENIEDFGEFTFYHNGYTPGQYGVGFLVKKELKECIDEFIGISERIILLNLKLPPLDEMWSIVQIYSPTEQATSTEIDSFYLQLTETIKTYSCSNLIVMGDFNARTGYRVEGEDIVLGPYSTGKRTRNGEKLIHLAYENNLKILNSYYKNRPRNRWTWTSPDGRYKNEIDYILSNRSTAFQDCRVINNLNFNSNHRPVRAKLKLNTSKKRPFKANLTNKTTSLNTKQSSY

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR027124   Swc5/CFDP2       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
391
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00191
Exp number, first 60 AAs:
0.00137
Total prob of N-in:
0.01052
outside
1  -  391
 
 

Population Genetic Test Statistics

Pi
256.530843
Theta
27.926155
Tajima's D
-0.56044
CLR
1.886064
CSRT
0.231288435578221
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号