SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14830
Annotation
blastopia_polyprotein_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 2.987
 

Sequence

CDS
ATGCCTTTTGGTCTCTCCGTTGGACCCTCTGTGTTCCAGAGATTTGTTAATGATGTGTTTCAGGACCTGATCTTGGATGGTGTGGTGTTGACCTATTTAGATGATTTGATCCTGCCATTTAAACTTCCTAAAGAAGGTATTGAGAAGTTACAAAAAGTTTTATACAGAGCTGAAGAATATGGACTAACTTTCAACTGGAGTAAATGTCAATTTATGCAGAAGAAAATTAACTATTTGGGTTATATCATTGAGGATGGTAAAATCAGTCCATCAAAAGAGAAAGTGACTGCTGTTGCTCGTTTTCCAACCCCACACAATATTAAGACTTTACAATCATTTCTTGGACTTACAGGATATTTCAGAAAATTTATCAAAAATTATTCTCTTATAGCAAGACCGTTAACCAACCTTTTGAAAAAAGGTGTTATTTTCAATTACGACGAAGAATGTGAGAAGGCAGTTGAGACCCTCAGAACTATTCTGTGTCAATCACCAGTTTTGCAGATCTACAATCAAGACTTAGAAACCGAACTCCACACTGATGCAAGTGCTGACGGCTATGGAGCTGTATTATTACAAAGAAACCTGAAAGATAATAAGATGCATCCAGTCTACTACATGAGCAGGAAGACTTCACCTGCAGAAAAGAAGTATCATAGTTACTATTTAGAAGTTTTAGCTGTTGTTGAAGCTATCAAGAAATTCAGAGTTTACCTGCTTGGAATCCATTTCAAAATAATCACTGACTGCTCTGCTCTGACAACAACTCTAAAGAAAAAAGACTTACCTCCAAGAGTAGCACGCTGGGCTCTGTTGCTTGAAGAATATAATTACACTATTGAACATAGACCTGGAATAAGAATGAAGCATGCTGACGCTCTCAGTAGACAACCTGTAGAAAACATCTTTATACTTACCGACACAACCGCCCGCCTCCGTAGAGCACAAGATGATGACCTAAAAATAAAACTGATTAAAAAGGTCTTAGAAAAAGAACATTATGATGACTTTATGATTGAAGCTGGAATATTATGGAAAATAAAAGATGGAAAAAAATTAATGGTGGTACCTAAGAAAATGCAAAATGAAATTATTAGAAAAAATCATGACAAGGGACATTTTGGATTAATTAAAACAGAAGAATTGATTTCCAGAAACTATTACTTTGAAAACATGAAAGATAAGATCAAATCAGTATTAGAAAACTGCTTAGAGTGTATTTTAATTTCACATAAAAAGGGAAAATCCGAAGGTTTTCTGCATGCCATAGACAAAGGAGACATACCACTATCTACTTACCATATTGACCATTTGGGACCGTTGACATCAACAAATAAGAATTACAAGTATATACTCACAGTTGTAGATGGATTCACAAAATTTACATGGATTTACCCAACAAAGACTTTGTCCACTGATGAAGTTATTGACAAACTGAAGATTCAACAACAGACTTTTGGTTCACCACAGAGGATTATTAGTGACAGAAGTACCTCCTTTACATCCAACACTTTTAAAGAATTTTGTGAAACTGAAGGAATCTTACATCACATTATTACTACTGGCCAACCTAGAGGTAATGGTCAGGTTGAGAGAGTCCATCAGATAATAATTGATGCTCTAAGTAAATTATCAGCAGATGATCCCACCAAGTGGTACAAACACATCAGTAATATCCAGAGATGCTTAAATGGTTCATTTCAAAGAAGCATTAAGATGTCACCCTTTGAATTACTGACAGGAGTCAAAATTAATAATAAAAATGAAGCTATCTACAATTTAATTAATGAAGAGAATCTTAAATTTTTCTGTGATGAAAGAGAAGACTTGAGGAAGAAAGCAAGGGAGAACATACAAAAAATTCAAGATGAGAATAGAAGAAATTTTAACCGAAGACGAAGGAAACCCAGAGAATATGAAGTAGGAAATCTTGTTGCTATCAAGAGGACACAATTTGTGCAAGGCTACAAACTGCATCCAAGATACTTAGGACCTTATGAAGTCGTGAAAAAGAAGAGGAACGACCGTTATGATCTCCAGAGGATTGGTCAAGGTGAAGGACCCCATCACACCAGTAGCTCCGCGGATATGATGAAACCTTGGGTCGCTGATGCTGTCGAGTATGAGTCATCTGGGACAGACGACTGA
Protein
MPFGLSVGPSVFQRFVNDVFQDLILDGVVLTYLDDLILPFKLPKEGIEKLQKVLYRAEEYGLTFNWSKCQFMQKKINYLGYIIEDGKISPSKEKVTAVARFPTPHNIKTLQSFLGLTGYFRKFIKNYSLIARPLTNLLKKGVIFNYDEECEKAVETLRTILCQSPVLQIYNQDLETELHTDASADGYGAVLLQRNLKDNKMHPVYYMSRKTSPAEKKYHSYYLEVLAVVEAIKKFRVYLLGIHFKIITDCSALTTTLKKKDLPPRVARWALLLEEYNYTIEHRPGIRMKHADALSRQPVENIFILTDTTARLRRAQDDDLKIKLIKKVLEKEHYDDFMIEAGILWKIKDGKKLMVVPKKMQNEIIRKNHDKGHFGLIKTEELISRNYYFENMKDKIKSVLENCLECILISHKKGKSEGFLHAIDKGDIPLSTYHIDHLGPLTSTNKNYKYILTVVDGFTKFTWIYPTKTLSTDEVIDKLKIQQQTFGSPQRIISDRSTSFTSNTFKEFCETEGILHHIITTGQPRGNGQVERVHQIIIDALSKLSADDPTKWYKHISNIQRCLNGSFQRSIKMSPFELLTGVKINNKNEAIYNLINEENLKFFCDEREDLRKKARENIQKIQDENRRNFNRRRRKPREYEVGNLVAIKRTQFVQGYKLHPRYLGPYEVVKKKRNDRYDLQRIGQGEGPHHTSSSADMMKPWVADAVEYESSGTDD

Summary

EMBL
LBMM01010976    KMQ87102.1    LBMM01005919    KMQ91096.1    KMQ91095.1    GEHC01000930    + More
JAV46715.1    LBMM01011782    KMQ86633.1    GBXI01005773    JAD08519.1    GBBI01004551    JAC14161.1    GBBI01004550    JAC14162.1    GBBI01004549    JAC14163.1    GBXI01004632    JAD09660.1    ABLF02014660    ABLF02042774    GAMC01015907    JAB90648.1    GBBI01004477    JAC14235.1    ABLF02005846    IAAA01004058    LAA02042.1    IAAA01004056    LAA02037.1    GAMC01020207    JAB86348.1    GAKP01016237    JAC42715.1    GAMC01007326    JAB99229.1    IAAA01004057    LAA02040.1    GBBI01004613    JAC14099.1    GAKP01016235    JAC42717.1    NWSH01002797    PCG67520.1    GBXI01015151    JAC99140.1    ABLF02005127    ABLF02005129    ABLF02007401    GGFK01005990    MBW39311.1    GGFK01007168    MBW40489.1    GAMC01002791    JAC03765.1    AY050234    AAK84933.1    Z27119    CAA81643.1    GAKP01019383    JAC39569.1    GGFL01001689    MBW65867.1    ABLF02023724    GGMR01018192    MBY30811.1    LBMM01011790    KMQ86624.1    LBMM01012647    KMQ86079.1    ABLF02040951    GGFM01003105    MBW23856.1    IAAA01041298    LAA10248.1    GFTR01008753    JAW07673.1    GEZM01051217    GEZM01051215    JAV75083.1    ABLF02041876    ABLF02004526    ABLF02054969    GGMR01015682    MBY28301.1    GEZM01033083    JAV84424.1    GGMR01005091    MBY17710.1    GFXV01005120    MBW16925.1    GEZM01034557    JAV83728.1    ABLF02017401    ABLF02004401    ABLF02013544    ABLF02013550    GEHC01000888    JAV46757.1    GEZM01005427    JAV96179.1    ABLF02008401    ABLF02008404    ABLF02033943    ABLF02042737    GGMR01003388    MBY16007.1    GGMR01015631    MBY28250.1    GGMR01009949    MBY22568.1    GBYB01013920    JAG83687.1    ABLF02022032    GEZM01098134    JAV53984.1    ABLF02003120    ABLF02004015    ABLF02057179    ABLF02066208    GGMR01016004    MBY28623.1    ABLF02005879    ABLF02005881    KQ460883    KPJ11409.1    GEGO01004299    JAR91105.1    GEHC01000891    JAV46754.1    GEHC01000876    JAV46769.1    LBMM01004291    KMQ92598.1    GEHC01000880    JAV46765.1    GEZM01089269    GEZM01089265    JAV57567.1    GEZM01089268    GEZM01089261    JAV57577.1    X95908    CAA65152.1    GBHO01007445    JAG36159.1    GGMS01008442    MBY77645.1    KQ971339    KYB27733.1    KQ971338    KYB27888.1    ABLF02030153    KYB27887.1    GGMR01014623    MBY27242.1    KQ971307    KYB29884.1    LBMM01006880    KMQ90234.1    GGMS01012726    MBY81929.1    GAKP01001563    JAC57389.1    GGMR01018805    MBY31424.1    ABLF02042434    ABLF02008500    ABLF02009922    ABLF02037454    ABLF02037455    ABLF02011079    ABLF02024793   
Pfam
PF17919   RT_RNaseH_2        + More
PF17921   Integrase_H2C2
PF00665   rve
PF00078   RVT_1
PF00098   zf-CCHC
PF02037   SAP
PF17917   RT_RNaseH
PF09668   Asp_protease
PF00077   RVP
PF12384   Peptidase_A2B
PF03732   Retrotrans_gag
PF13873   Myb_DNA-bind_5
PF16064   DUF4806
PF14392   zf-CCHC_4
Interpro
IPR001878   Znf_CCHC        + More
IPR012337   RNaseH-like_sf       
IPR036875   Znf_CCHC_sf       
IPR036361   SAP_dom_sf       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR000477   RT_dom       
IPR003034   SAP_dom       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR021109   Peptidase_aspartic_dom_sf       
IPR041373   RT_RNaseH       
IPR019103   Peptidase_aspartic_DDI1-type       
IPR018061   Retropepsins       
IPR024650   Peptidase_A2B       
IPR005162   Retrotrans_gag_dom       
IPR011764   Biotin_carboxylation_dom       
IPR034145   RP_RTVL-H-like       
IPR028002   Myb_DNA-bind_5       
IPR032071   DUF4806       
IPR025836   Zn_knuckle_CX2CX4HX4C       
IPR034122   Retropepsin-like_bacterial       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF68906   SSF68906       
SSF50630   SSF50630       
Gene 3D
PDB
4OL8     E-value=2.00739e-46,     Score=471

Ontologies

Topology

Length:
715
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00195
Exp number, first 60 AAs:
0.00082
Total prob of N-in:
0.00009
outside
1  -  715
 
 

Population Genetic Test Statistics

Pi
54.274574
Theta
62.795379
Tajima's D
-0.736584
CLR
0.043381
CSRT
0.188390580470976
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号