SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14806
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Amyelois_transitella]
Location in the cell
Mitochondrial   Reliability : 1.044 Nuclear   Reliability : 1.715
 

Sequence

CDS
ATGGATCTGTACACTAAGTTACAAGAGGTGGAATCAAGCGTTGTGCAGAGGATGACTGAGTTTGAAGCAATGCTGAGCAGTCACCAGTCACCACACACGGACCTAGGCAAGTTGTCACAAGATTTCATCGCATTCCGGAATCTCACACTACAAACACTCAACATGCTGAGGTCACAGATGGAGCTTGTTCTCTTGGGGTTGGACAGGCATGAGATGGCGTCGCGTCGTAAGGTCCTTCTGTTTCATGGAATCCCGGAGTCAGATGCCACAGACCCAGCAACAGCAATTGTGGGTATATTAACCAACCAAATGAAGGTGGCTGGTTGCACAGAAGAGGACTTAACTGCTTGCTATCGGTTAGGCTCCAACACCAATAAGCCTAGGCCTATATTAGTCAGGTTCCTGAGTTTGAGGCGATGCAATGAAGTGTGGAAGAACAAGACACTCCTGAAGGGTTCTAGGGTCATCATTTCAGAATTTCTGACCAAATCACGTCATGATGTCTTTTTGGAGGCCCGCTCTCATTTCGGCGTTAAGCGCTGCTGGACAACAGATGGGAAAATAATCGTCCTTCTCCCGGATAATAAACGCTGTAAGATTGAACAGATGTTTGAACTTCAGCATCTGAAAACCAAGTTTCCCTCGGCTCAAAAAGCGCAAGGAGCTCCTCAGTCATCTGGGAAATCTCATGACGAACCCAAGACGGCACCAAAATCAGCGGCAGAGCGAGAAATCGGCAAGAGGACGACTCGTCGAAAGTACTTCAAGGGTATAGGCGTGGAGCGATTGCGGGCTGACGCGAGGAATGTTGACTGGTCGACTGTCTTTGGCTCTGACACGATCGATGACATGTCTGGTTTCCGCCAAGGCCACAGCACGGTCACTGCATTGCTCAAGGTCACTGACGACATTCGCCACGCGATTGATGTGGGGCAGCTAACCGTGTTGACCTTATTGGACTTCAGCAGTGCTTTTAACTCAGTAGACCTTGACATCCTTCTAAGTATCCTTGGATCTCTTAATGTATCTCCACTTGCTCTAACCTGGTTTGAATCTTATCTCCGGGGACGCTCGCAGTGTGTCCGTTCTGATGATGCTACTTCAAAATGGTGTGATTTAACTGCGGGTGTACCTCAAGGTGGCGTACTATCTCCTCTCCTTTTCTCTATTTTCATTAATGAAATTACTCAGGTGCTGACTTCTCACTACCATCTCTACGCTGACGATTTGCAGATTTATAGACATTTTAAAGCTGATGACGTTGCTCTAGCTATTGCTGAAATCAATGGAGATCTTGGTAGAATTAGTGCTTGGGCTAAATCTTTTGGACTTCTTGTGAATCCATCAAAATCACAGGTCATAGTAATTGGTAGTTCCTATAGGTACAACACGATTGACCACATTAATTTGCCCCCTGTGACGCTAGATGGAATTCCAATCGCTTATTCTAAAACAGCAAAAAACCTAGGTATCGTTCTTGATTGTCATCTCTCTTGGTCCAGTCAGATAAACTTAGTTAGCAGGAAAGTGCATTGCACGTTTCAGTCTCTCAAGCGTCTTCAGCGTTTCTTGCCCTTTGAAGCTAAAGTCACCCTGGCCCAATCCCTTATGCTTCCTCTCCTTGACTATGCAGATGTCTGTTTCCTGGACGCCGCGGAGGGGCTGTGGGACAAACTGGAAAGGTTACAAAATTTATGCATACGCTTTATTTTTGGTTTACGCAAATATGATCATGTCTCGCAGTACAGATCACAACTTAATTGGTTACCTATCCGACTTCGCCGTGATGTACATGTTTTATGTATGCTGTTCAACATCCTTAATAACCCAGCTGTTCCCCGGTACCTCCGTGAGCGCTTCGATTACCAGATGCCCCGAGGTGTACCCTGTCGTACAAGTAGATCCCTTCTCCTTAATTTTCCCCCTCACTCCTCCAGCCGCTACGGCGGTTCGTTCACTGTGCAGTCTGTGCGTCTGTGGAACTCAGTTCCACACTCAATCCGTGCAAGTCCCTCACTTGAGGTATTCAGGAAGGCATTAAAGAAGCACTATCTATCTATTTAG
Protein
MDLYTKLQEVESSVVQRMTEFEAMLSSHQSPHTDLGKLSQDFIAFRNLTLQTLNMLRSQMELVLLGLDRHEMASRRKVLLFHGIPESDATDPATAIVGILTNQMKVAGCTEEDLTACYRLGSNTNKPRPILVRFLSLRRCNEVWKNKTLLKGSRVIISEFLTKSRHDVFLEARSHFGVKRCWTTDGKIIVLLPDNKRCKIEQMFELQHLKTKFPSAQKAQGAPQSSGKSHDEPKTAPKSAAEREIGKRTTRRKYFKGIGVERLRADARNVDWSTVFGSDTIDDMSGFRQGHSTVTALLKVTDDIRHAIDVGQLTVLTLLDFSSAFNSVDLDILLSILGSLNVSPLALTWFESYLRGRSQCVRSDDATSKWCDLTAGVPQGGVLSPLLFSIFINEITQVLTSHYHLYADDLQIYRHFKADDVALAIAEINGDLGRISAWAKSFGLLVNPSKSQVIVIGSSYRYNTIDHINLPPVTLDGIPIAYSKTAKNLGIVLDCHLSWSSQINLVSRKVHCTFQSLKRLQRFLPFEAKVTLAQSLMLPLLDYADVCFLDAAEGLWDKLERLQNLCIRFIFGLRKYDHVSQYRSQLNWLPIRLRRDVHVLCMLFNILNNPAVPRYLRERFDYQMPRGVPCRTSRSLLLNFPPHSSSRYGGSFTVQSVRLWNSVPHSIRASPSLEVFRKALKKHYLSI

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
687
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.10022
Exp number, first 60 AAs:
0.0005
Total prob of N-in:
0.00096
outside
1  -  687
 
 

Population Genetic Test Statistics

Pi
175.040641
Theta
196.348461
Tajima's D
1.812666
CLR
0.113466
CSRT
0.850307484625769
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号