SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14802
Pre Gene Modal
BGIBMGA012137
Annotation
PREDICTED:_major_facilitator_superfamily_domain-containing_protein_6-like_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 3.878
 

Sequence

CDS
ATGAAGATTAACAAAAGCTTGCTGCCTGTAAAGGCGCATTTCTTCTTTTTCTTCGCCGCCCTGGGGCCGCTGTTGCCGCAAATGAATGTGTTCGGGCGGCAACTGGGAGTCACGCCCGCAGCGATGGGAATCGTGACAGCTATTCTGCCCCTGCTGTGGGCGACTGCGAAGCCACTCTTCGGCTACGTTGTAGATTATTGGCCGGCGCACAGGAAGCTAGTATTCATGCTACTAATATCGGTTATGACTGGGTCGTACTGTTGCCTCTGGTTCCTGCCCACCCCGGAAACCGTCGAGCCGCCCCTCCTAGAATACGTTTATAAACTGGAAACCGTTGATTTGAGACGAAACGATCAGTCCCTGAACTTAGAAAAGTACACGTGCCACTGGAATTGTACTCCGGGAACGTTCGATGTGTACCTGCGGAACACGACCGTCATCGATACGGCATACTTGGACAGTGACGTCACGAATTCGACCTGTCTGACCCTGAACATGGACTTAAGCGAAGTTCGAGATGGGCAAGTGAAGTGCACGCCCAGAGACGGCTGCGATTTGTTGTGCTACGAAAAGGGATTGAATCGAGTTAAAAGAGAGATATCAGGTTCCACTAAGAATTTGGTTGACGTTAATGAGAAGAACTCTGGAGATTCTTCTGTTGAAACGGGTGGAGGGGGTAGCGTCTATGTGAGTCTTACGTTTTGGGCGTTCGTGGTTCTGATGAGTCTGGGTACAGTGGCGTTTAATGTGGCCAATTGTATCGGTGACGCCGTGTGCTTCGACGTGCTTGGTCCAGATCGAGGGTCAAAATACGGTGCCCAACGAGCTTGGGGCACTATCGGATATGGGGTGACGGCCCTGCTGGGAGGTTGCCTGGTGGATATGGTATCTGATGGCAAGTACAAGGACTACACGCCGGCGTTCGTGATAGCCCTAATTGCGACCGGCATCGATCTGTATAGCTGCAGAGCGTTGACGCTACCCTCATTATCGAGCCCCACCGATTCCGGTGCGGCATTACGGTCTGTACTGCGGATACCGAAGGTGATTGTGTTCATAGTGTTCGCCGTACTGGCGGGCACATTCGACAGCTTCATAATCTATTACATGTTCTGGTTCCTGGAAGAATTGGCCGAGGAAACCGGTTCGATTGCTACGATAAAGCTCATCGAGGGCGTGGTGGTAGCCGCTCAGAGCTTCGTCGGGGAGCTTCTGTTCTTTTTCTGTTCAGGTAAAATAATAAAGCGCTGGGGCTACGGAACGACGCTGACGTTCTCATTGTTCTGTTACGGAATTAGAATGGCGTTGATATCGTTCATACGGAATCCGTGGCAATTGGTGTTGATAGAGGGGATTATGCAAGGCCCGACATATGCCCTTTGCTACGCTACTATAGTCGGGTACGCGGCTCATGTGGCCCCGGACGGTTACTCGGCGACTGTCCAGGGCATAGTGGCCGGCATGGACGACGGCGTGGGTGCGTATTTGAAATACCAGATCAGAGGTGTAAGAAAAGATGCTGAGTGGTTACCGTCGCCCATGGACTTCAGCAATGCCGGATGGTACGTGGCAAAAAAGATCTCTGGAAACGCACTGTGGATGACCGCAGTGGCTCCAGGTAGTATGGATGAACTCTACTCCGGCGGCGGGCGGTGCGATGGTTTCGCCCTGGGCTCGCTGCTAGGCGGACAACTTTACGGTTCGATGGGCGGTCGATATTCCTTCCGCGTGTTCAGCGTATTGGCGGTGATGGCGGCCGTCCTCCACGCCGCGATGTTCCTGGAATTCGATCGGGCTGAGAGGTCTAAGGCGCAAGCAGAGCTCGTAGAGGCAGAGAAGATGCTTCGTCCTAATCAAGCTGTGTACAGAGAGACCGTCGTATCTACAGATTCCTGTTGGACGAATGACGATGGTGATAAGCCGAAGGTGACTCGGTTCGTTGGTAGACGCCAATCAGAAGTGGATGAAGACTGTGATGATTATAATTATGATGATGTCGTAATGCCTGATGATTTAGGGGAATACCAGGATTCAGACACGCGAGATTGCGATGAAAACATACAAATAGAAACGGTATATTGTTATGAAGACGATTCCACTTGTTATGTTGATAATAATAATGATGATGATGATTGA
Protein
MKINKSLLPVKAHFFFFFAALGPLLPQMNVFGRQLGVTPAAMGIVTAILPLLWATAKPLFGYVVDYWPAHRKLVFMLLISVMTGSYCCLWFLPTPETVEPPLLEYVYKLETVDLRRNDQSLNLEKYTCHWNCTPGTFDVYLRNTTVIDTAYLDSDVTNSTCLTLNMDLSEVRDGQVKCTPRDGCDLLCYEKGLNRVKREISGSTKNLVDVNEKNSGDSSVETGGGGSVYVSLTFWAFVVLMSLGTVAFNVANCIGDAVCFDVLGPDRGSKYGAQRAWGTIGYGVTALLGGCLVDMVSDGKYKDYTPAFVIALIATGIDLYSCRALTLPSLSSPTDSGAALRSVLRIPKVIVFIVFAVLAGTFDSFIIYYMFWFLEELAEETGSIATIKLIEGVVVAAQSFVGELLFFFCSGKIIKRWGYGTTLTFSLFCYGIRMALISFIRNPWQLVLIEGIMQGPTYALCYATIVGYAAHVAPDGYSATVQGIVAGMDDGVGAYLKYQIRGVRKDAEWLPSPMDFSNAGWYVAKKISGNALWMTAVAPGSMDELYSGGGRCDGFALGSLLGGQLYGSMGGRYSFRVFSVLAVMAAVLHAAMFLEFDRAERSKAQAELVEAEKMLRPNQAVYRETVVSTDSCWTNDDGDKPKVTRFVGRRQSEVDEDCDDYNYDDVVMPDDLGEYQDSDTRDCDENIQIETVYCYEDDSTCYVDNNNDDDD

Summary

Pfam
PF12832   MFS_1_like        + More
PF07716   bZIP_2
Interpro
IPR036259   MFS_trans_sf        + More
IPR020846   MFS_dom       
IPR024989   MFS_assoc_dom       
IPR004827   bZIP       
SUPFAM
SSF103473   SSF103473       

Ontologies

Topology

Length:
711
Number of predicted TMHs:
11
Exp number of AAs in TMHs:
227.18567
Exp number, first 60 AAs:
40.03273
Total prob of N-in:
0.99151
POSSIBLE N-term signal
sequence
inside
1  -  12
TMhelix
13  -  32
outside
33  -  41
TMhelix
42  -  64
inside
65  -  72
TMhelix
73  -  95
outside
96  -  231
TMhelix
232  -  254
inside
255  -  274
TMhelix
275  -  297
outside
298  -  306
TMhelix
307  -  329
inside
330  -  349
TMhelix
350  -  372
outside
373  -  386
TMhelix
387  -  409
inside
410  -  415
TMhelix
416  -  437
outside
438  -  451
TMhelix
452  -  474
inside
475  -  573
TMhelix
574  -  593
outside
594  -  711
 
 

Population Genetic Test Statistics

Pi
248.003732
Theta
154.457588
Tajima's D
3.041038
CLR
0.220863
CSRT
0.981050947452627
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号