SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14801
Pre Gene Modal
BGIBMGA014357
Annotation
gag-pol_polyprotein?_partial_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 3.385
 

Sequence

CDS
ATGGATTCTACAGTTTATGCAGCCAATGATGAAAAAATGAAAGCACAAGGATCAGGTACTGTCCATGGAATCTCATGTGATTTACAAAAGACTTTATTTATACCAGACCTAGCACAAAACCTTTTGTCTGTAAATTGTGTTACCAACAATGATGGCTCTGTTGTGTTCACAAAGAATAAAGTGGAGATTTACAAAAATTCAAAATTAATTTTAACCGGCAAAAAAGAAAATGGCTTATACAGGGTGAATTTAGTACAAGACCTGAAAAATAAAAATAAATCTTTACTTACACAAGTAAATGGAACAGCATTGGAATGGCATGCAAAACTGGGACACCCAGGTAAATCAGTACTAGAAACACTAACAAAAGTTGCAGACGGCATAAATATACAAGGACCAAAAGTATTACAAGAACAGTGTAAAATATGTGCTGAAGCAAAACAGTCAAGACTACCATTTACTACAATCAGAACTCGTGCTGAAAGATACCTACAAATAATACACACAGACATATGTGGTCCCTTCGAGGAAAAGACTCATGATGGATATAGATATGTATTAACAATAATGGACGACTACAGTCATTTTACAAAAATCTATTTACTTAAAAACAAGAGCGATGCAAAAGCAGAAATTAAAAATTATATTGAAGAAACGGAGCGAGAGAAAAATAGTAAAGTATCAATTATAAGATGCGACAACGGAGGTGAATATACAAGTAACGATTTTAAAGCATTTTGTCAACAAAAAGGCATAAAATTAGACTACACAGTGCCCTACTCACCACAATTAAATGGAAAAGCTGAACGCCTAAACCGGACATTATTAGAAAAAACAAGAGCATTACTCTTTGATTCTAAATTGAACAAAGAAATGTGGGGTGAAGCAATATATTGTGCTACTTATATTTTAAACAGACTACCAAGTGATGCCCTGAAAAACAAAACACCATATGAAATGTGGGTTGGAAAAAAGCCTAATATATCTAATATGCAAAAGTTTGGTTCTACTGTCTATGCAAAACAGTTACATCCAAATGTAAAGAAACTGGATCCTAGAAGCAAGAAACTAATAATGATTGGATACACTAATAATGGGTACAGACTGTGGAATGACAAGGAGAGAAAAATAGAGATATCAAGGGACATAGTGATAGTAAAAAGTGAAACTGAACAAAAGAAAGAAAACTATAAGAAAATAAATAATAATAAAAGTGAAAATGATGAAAAAGAGACAACAGAAAACCAGGAAGAGACTATAGAAAACCAGGAACAGATTATAGAACAGCAGGAAGAGACAACAGAAGATACCAGAACAGAAGATAATAAAAATGATGAGACTTTTGAAGATGTAGTATCAGAAACTGAATCAGAAGACACAGAAAGAGAAAGAAACAGACATCATGAAGAAAACGGTTACCTAAGAAGAAGCAAGAGAATTAAACACATACCAATACATTTAAGAGACTACAGTTTACTTACTTACAGAGAGGCTGTAACATCTAAAGAGGGAGAAAACTGGGAGAAGGCCATAAATTCGGAGAAGGAATCCCTAAAAATCAATAATACCTGGGAAATAGTAGACAAGAAAGAGGCAAAAGATAGTAAAATACTTACAAACAAATGGGTATTCCGTGTGAAAGATAATGGGACTTATAAAGCTAGACTTGTCGTACGAGGATTTGAACAAAATAGTATTGACTACAATGAAATATACAGTCCAGTTGTCAGTCAGTCAACTTTAAAATCTTTATTTGCACTTGCTGCTTCTAAAGACTATAACATGATGACATTTGATGTTAAGACTGCATTTTTATATGGAGAGCTGGATGAAAATGTGTATATGAATATACCGGATGATGATGGACTTGCTTTGGCTAAAGAAAAGCAAACATTAAAAAACATTTTAAACTGCTTAGAAAAGGAATTTGAAATAAAAGTATACAATGATCCTACTACTTTTATTGGATTTGAAGTCAAAAAGACTGAGAAAGGTATAACACTGAAACAAGAAAGCTACATTGGAAACTTATTAAAGAAATTCAGTATGGAAGATTCTCAACCTGTTAATACACCCTGCAATACAGAAAATAAAACAGAAACGCAAAACACAGATTCTATAAATTTTCCATATAGAGAACTGATTGGAGGACTTCTATATGTATCTACAAGAACAAGACCAGACATAAGTCAAGCTGTAAATGAAGCAAGCAGAAAAATAGAAAACCCTACGAAAGATGATGTGATAGCTGCAAAGAAAATACTAAAATATTTAAATGGAACAAGACAGAAAGGAATCATGTACAAGAAAGGAGGAGATATGTCAAAACTAAATGCATACTGTGATGCAGACTATGCCAATTGTATCAAGACAAGACGCAGTACAACCGGATTTGTGATAATGTTAGCAGAAGGACCTGTCTTGGTGTTCAAAACGACAACCAATCGTTGCATTATCATCAACTGA
Protein
MDSTVYAANDEKMKAQGSGTVHGISCDLQKTLFIPDLAQNLLSVNCVTNNDGSVVFTKNKVEIYKNSKLILTGKKENGLYRVNLVQDLKNKNKSLLTQVNGTALEWHAKLGHPGKSVLETLTKVADGINIQGPKVLQEQCKICAEAKQSRLPFTTIRTRAERYLQIIHTDICGPFEEKTHDGYRYVLTIMDDYSHFTKIYLLKNKSDAKAEIKNYIEETEREKNSKVSIIRCDNGGEYTSNDFKAFCQQKGIKLDYTVPYSPQLNGKAERLNRTLLEKTRALLFDSKLNKEMWGEAIYCATYILNRLPSDALKNKTPYEMWVGKKPNISNMQKFGSTVYAKQLHPNVKKLDPRSKKLIMIGYTNNGYRLWNDKERKIEISRDIVIVKSETEQKKENYKKINNNKSENDEKETTENQEETIENQEQIIEQQEETTEDTRTEDNKNDETFEDVVSETESEDTERERNRHHEENGYLRRSKRIKHIPIHLRDYSLLTYREAVTSKEGENWEKAINSEKESLKINNTWEIVDKKEAKDSKILTNKWVFRVKDNGTYKARLVVRGFEQNSIDYNEIYSPVVSQSTLKSLFALAASKDYNMMTFDVKTAFLYGELDENVYMNIPDDDGLALAKEKQTLKNILNCLEKEFEIKVYNDPTTFIGFEVKKTEKGITLKQESYIGNLLKKFSMEDSQPVNTPCNTENKTETQNTDSINFPYRELIGGLLYVSTRTRPDISQAVNEASRKIENPTKDDVIAAKKILKYLNGTRQKGIMYKKGGDMSKLNAYCDADYANCIKTRRSTTGFVIMLAEGPVLVFKTTTNRCIIIN

Summary

Uniprot
ProteinModelPortal
PDB
3S3N     E-value=3.06521e-09,     Score=151

Ontologies

Topology

Length:
821
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.22592
Exp number, first 60 AAs:
0.00024
Total prob of N-in:
0.00016
outside
1  -  821
 
 

Population Genetic Test Statistics

Pi
475.090113
Theta
201.982968
Tajima's D
4.210261
CLR
0.283152
CSRT
0.99950002499875
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号