SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14799
Pre Gene Modal
BGIBMGA012214
Annotation
PREDICTED:_uncharacterized_protein_LOC106792377_[Polistes_canadensis]
Location in the cell
Nuclear   Reliability : 2.862
 

Sequence

CDS
ATGAAATGTATTTTATCATTAAATATTGAGGATCATCCTTTTAAGAAGATGTCGGATAGATTGATTACGGGTTTTCAAGGTTCGATATTGAGTCTGGAGATAAAGGTGACACTATGGAAATTAGAGCAACAAAATAAACGGATAGTAGACATGGAGGATAAAGTTAAAGATGTACAGCTACCAACTGAAGTAGAAATGATATTGAACTTAGAACCTAAGTTTGGTATAGAAATAAAAGAAAAGTGGAAGGTGATACCAACTGTGATTAAGGATTTAGAATTTGGAATTGAAGCTGTACAGTTGGATGATTGTAACGATGAAGGAAAAGATATTGTTAAGAATAATTTGAGATCTAAAGCGATTAATTATGACACTGAAATGAGAAAGATGTTGAATGACAAGGTGACATATAAATTACTGAAAAAGGATCCTACAAATAAATGGCAAAAAGTTGCAAACAGTTTAGTGAACAAGTTAGTAGTAGCAAAAATTGTTGAGGAACAACAAGGTAAACATCTGAAAGCAAAGTATACTGTTGCACCCAGGATTTATGGTTTGAGGAAAACACATAAGGAGACTTGTTGTTTGCGTCCAGTGGTCAGTTGTGTTAATTCCCCGAGTTACAGCCTGGCACGGTTCCTACATGAAATACTGACTCCAGTGATTGAGAAGTTTCAATATAATGTAAAAAATTCATTTGACTTCGTGACATTTAGTAGAAAGGTTAGCTTACCGAAGAATTATGTACTGATTTCATTGGATGTAGTGTCATTGTTCACGAATGTACGTCGTGACTTGATTCTTAAAGTAATTGAGGAAACTTGGGATAACATGAAGCATTTAGTAAAAATTCCTAAGAGTGTGTTAGTTGACCTCATTACGTTTTGTTATGATTCAAGTTACTTTGTATATCAAGGAGAGTTCTATGCACAAACGGAAGGCAGCAGTATGGGAAACCCTGCAAGTCCAGTCATAGCTAACATCGTTATGAACTATGTCATCGATCAGATATTGAAGATTCTACCGTTTGAAATTCACTTCTTAAAGTTATACGTGGATGATACTATCGCAGCCATACCGGAGTCGGAAGTAAATAATATCTTAGAGTTATTTAATAGCTTTGACAATAATATACAATTTACCATGGAAGTAGAAAAGGATGATAGTTTATCTTTTCTAGATGTGTTAGTCAAAAGATCAAATGATAAATTGATAACTGATTGGCAGAAAACGGGATGCACTGGTCGCGGCCTTGGGATCGCGGCCGCGGTCGGTGTCGGCGTTGGTGCTGCTTTGTATTACTTCTTAAGCAAAAGGCCTGAGCAACCCGATACTGAGGGTTCCACCAGTTCTGCGTGGGCATACAACGATCACAGTGCTTTAGCGGAAGACAGCCAGATAAATAGGCTAAGGGATGAGCACTTCCGTAAGCGCTCGTGGTCGTTGGAAGAGTGCTCCATCTGCTTCGAGATCATGCTGAAGGATCAGGAGCTGATGGCCCTACCGTGCACCCACAATTTCCACTCGCAGTGCATCATGCCCTGGCTTCAGGAGAAACAGACGTGCCCCAATTGCCGGAAGGACGCCTGA
Protein
MKCILSLNIEDHPFKKMSDRLITGFQGSILSLEIKVTLWKLEQQNKRIVDMEDKVKDVQLPTEVEMILNLEPKFGIEIKEKWKVIPTVIKDLEFGIEAVQLDDCNDEGKDIVKNNLRSKAINYDTEMRKMLNDKVTYKLLKKDPTNKWQKVANSLVNKLVVAKIVEEQQGKHLKAKYTVAPRIYGLRKTHKETCCLRPVVSCVNSPSYSLARFLHEILTPVIEKFQYNVKNSFDFVTFSRKVSLPKNYVLISLDVVSLFTNVRRDLILKVIEETWDNMKHLVKIPKSVLVDLITFCYDSSYFVYQGEFYAQTEGSSMGNPASPVIANIVMNYVIDQILKILPFEIHFLKLYVDDTIAAIPESEVNNILELFNSFDNNIQFTMEVEKDDSLSFLDVLVKRSNDKLITDWQKTGCTGRGLGIAAAVGVGVGAALYYFLSKRPEQPDTEGSTSSAWAYNDHSALAEDSQINRLRDEHFRKRSWSLEECSICFEIMLKDQELMALPCTHNFHSQCIMPWLQEKQTCPNCRKDA

Summary

Pfam
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR000305   GIY-YIG_endonuc       
PDB
2ECT     E-value=1.0402e-07,     Score=136

Ontologies

Topology

Length:
529
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
13.72497
Exp number, first 60 AAs:
0.05591
Total prob of N-in:
0.03009
outside
1  -  529
 
 

Population Genetic Test Statistics

Pi
301.743168
Theta
157.053357
Tajima's D
0.770372
CLR
107.785018
CSRT
0.593370331483426
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号