SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14765
Annotation
PREDICTED:_uncharacterized_protein_LOC105841668_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.579
 

Sequence

CDS
ATGCTAGAGACAGATGAGTATGCTGGTCGATTTAGGGAAATAATGATAGAAAACATCTTGGAAATGAAGGATATGAAAGAGAAATCTGCGAATGATTGTTGGGATGAAATGGCAAATAGTGTCAGGAAGACAGCTAAGGCTGTGCTCGGCGAATCAAAAGGGAAAGGTATAATTGACAAGGATACGTGGTGGTGGAATGAGAATGTACAGAGAGAATTGAAAGAAAAGAAGAATGCATTCAAAAAGTGGCAACTAGAAAGAGGTAATGAAAGTGAGAGGCAAGCTAGGAAGAATGAGTATAGAGAATGTAAGAAAAAGGCCACTAAAGCGGTTGCTATAGCCAGGTCTGACGCTCAGAAACGGTTGTATGCCGCTTTAGATGAACCTCGTGGACAAAAGGAACTTTACCGTATTACAAGAGCTAGAGAAGAAAGTGCGAAAGATATTAAGCATGTCAGATTACATCGCTGCACGGACTCAGATATGGACGCTAAGTTAAGATTACTCCTGTTGTTCGTATTGTTCGGAGCGCTGACAGCCCTGATGCCGGAAGAAAATTTCAGTGCTGCCAATATTAATAATTCTAACGTACCGGATACGGATGCAACGCAAAGGAATTGCACGACAGGCAATGGAACACCGGGGTCGTGCGTCCTCCGACGTTATTGCGACTACGGGACTGTCTTCATAGATTTTACACTGTACGCTCCGCGAAAATATGTCAGACAATGCGGCGACAAAGAAGCTTGCTGCCCCTTCACCGCTCAGCTTCCGGTGCTCCAAGCAAACACTTCAGAAGATGACGCTTCGTTTGAATTTGACGAAAACGATTAA
Protein
MLETDEYAGRFREIMIENILEMKDMKEKSANDCWDEMANSVRKTAKAVLGESKGKGIIDKDTWWWNENVQRELKEKKNAFKKWQLERGNESERQARKNEYRECKKKATKAVAIARSDAQKRLYAALDEPRGQKELYRITRAREESAKDIKHVRLHRCTDSDMDAKLRLLLLFVLFGALTALMPEENFSAANINNSNVPDTDATQRNCTTGNGTPGSCVLRRYCDYGTVFIDFTLYAPRKYVRQCGDKEACCPFTAQLPVLQANTSEDDASFEFDEND

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
277
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
6.61656999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.37781
outside
1  -  277
 
 

Population Genetic Test Statistics

Pi
221.074921
Theta
159.840801
Tajima's D
1.384872
CLR
0.203953
CSRT
0.756262186890655
Interpretation
Possibly Positive selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号