SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14758
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Full name
Guanylate cyclase      
Location in the cell
Nuclear   Reliability : 3.041
 

Sequence

CDS
ATGGAGCAGGTAATGACCGCACTTCTTTCTATTCAAAAAGAACTCGACGAACAGAAAAAACTTATACACAAAAAAGGGGAAGAAGTGACAGAGAAGGTAACATTAAATATAAATAAGATACTAGAAGAGAAATTAAAAAATTTGGAAGAAAAACATGAAAACCTTAAGTCGAGGGTGGAAAATCAAGAGCAAAGATTATACTACATGGAGAGACAATCAAGACAACGTAATCTAGTCTTCTTTGGATTGGAGGAACACGAAAAATCCTACTCAAATTTAGAAAACACTATAGTAGACTTTGTACATAAATACTTCCCAATACAAATAGACCATAAAGACTTACAAGCGATCAGAAGAATAGGGAAGAGGACTAAAAAGCCACGACCGATAGTTATTACTTTCACAACACTTGGTAAGAAGATAGATATCTTAAAGGGCAAAGGAGCTTTAAAAGAAACACCGTATTATATCAAAGAAGACTACCCTCAATCAGTCTTGCAAAAAAGAAAAGAGCTACAGGAGCAAGTTATAGCAGAAAGAGAGAAGGGTAATAAAGCCATTATTAAATACGACAAGCTTGTTCTACTAAATAACTCATCCAAAGACCCGAAAAACAATAAAAGAAATCTATCAGAATCTCCAGAGAATAACACAATCAACCATGCCGGGCAGATATCTCAAGCAAACAAAAAGAACAAAACCTTGGCTGCCCACATAATCCAAAGGTCTCTGTCATCAATACACCGATACTTAGAACTCAATAATGCATTGAAAGATATAAAATGCGACATACTAGGACTCTCAGAAACAAGAAAAATGGGCTGCCACATAGAAGAGTATTCAGACTATGTTTTCTGCTATATAGGAGAAACAAAGGGATTGTATGGAGTCGGATTTTTAATAAAAAAGGCATGGAAAAACGATATAACTAACTTCACTGGCATTTCGGAGAGAGTAGCGCTACTTCAAATGAATTTTGGCGGACTAGACATTTCTATAATTCAGGCATACGCACCCACGGAAAAATCAGACGATACAGAAATACAAAAATTCTACAATGATCTGAAAAAAGCTCATACACTATCAAATGAGAAAATCATAATATTAGGAGACTTCAATGCAAAAATAGGGCAACCCAAAAAAGAAGAAAAACTCGTCATGGGACAGTACGGGCTAGGCCAAAGAAACGAAAGAGGCGAAAGACTGCTAGAATATGCATTGGAATATAGACTAGCAATAATCAACACTTATTTCAAAAAAAGACCCAGCAGAAGATGGACTTGGAAGTCACCAGACGAAAAAGTTAAAAACGAAATCGACTACATCATGACAAATGTCCCAAAAATAGTCCAAAATTATGAAGTTCTCAACAACGTAAAGTTCCAAACAGACCATAGACTACTTAGAGCAACAGTTCTATTGAGTCAAGCGAAAAAAAATAGAAAAGGCTTTAAACCACCACCAAAAATCCCAAAAAATGAAGAAGAAACAAGATACTACATAGACAGCCTCAAATCGAACATCGAAACCAAACTAGCAGATACCAGAAACGTTCAATCTTACTATGATGCGCTAGAAATAGCTATAACAAAAAGTTTAACTAGCAAAAACAATACAAAAAAAGAAAAACGACACAAAATATTTAGCGAAGAAACACTAGCCTTAATTAACAAACGCAGTGAATTAACTCTAAGAAAGAATAAAGATGCTGATACAAAGAAAGAACTAAGCAAATTATATAAGGAAACTAGCAAAGCGATTAAAAGAGACTATAGTAAGCACAGGCAAAGGATAATAACAGAAAAATTAAATAAATTCCGAAGCACAAAGAGAGCTTTTAAAGAATTAAACTTAAGAAAAACTTGGATACAAAAACTAGAAGGCCAACATAAAGAAATTACAACAAGACAAGAAATCGTACAGAAGGCAACTTCTTTCTACCAAGAATTATACAAAAACAAAAATAAAACCATCAAGGAAGCTAACGATTCACACAACTGTTATAACACGGAAACAATTAGACCGATAGAAGAAAAAGATACATACGCGCAGCTGAAGCATCTGAAATCAGATAAAAGTCCCGGTCCCGACGCAATAACCAATGAAGCTCTGAAAATAGGCGCACCAGTTTTACTTAAGCCTCTCACAGAATTATTCAATCTCATACTAGAAGCTGAAATCGTACCAATCCAATGGTGCACGTCGGACATCATATTACTATATAAAAAAGGAAACCCCCTCGATATCAACAACTATAGACCAATTAGCTTACTGGCAAATATATACAAAATCTTCTCATCTATAATTCTTAAACGCATAACACAAGAGATTGAAAAGGCACAACCAATAGAACAAGCTGGCTTTCGTTCTGGGTTTAGCACACTAGACCATATACAGGCACTAGAACAAGTTATAGAAAAATACGAAGAGTTTAATAAGCCACTCTATCTAGGTTTTATCGACTACAGCAAAGCCTTTGACAGCATAAGCCACAACTCTATATGGAAATCACTAAAGAAATTAAACATAAATTCGAAATATTTAAATATTATAAAATATATATACAACAACAGCATAAGTTATGTGAAGCTAGAATCTAGAGGTGATGCAATTAATATTGAAAGAGGAGTCAGACAGGGGGACCCCCTGTCACCTAAGCTGTTTATAGCGGTTCTAGAAGATGTATTTCGAAACACAGACTGGAAAAATAGAGGTATAAAAATAAACAACAGGTATCTAAGCCATCTCAGATTTGCGGACGACATAGTTATGCTGTCTGAAACAGCAAATGAATTACAAGATATGCTCCGCTCTCTTGTTCAAGCGAGCTCACAAGTAGGATTAGAGATGAATGCTACAAAAACCAAAATCATGACAAACAGCATAGAACGACCCATCAATGTAAAAGGAAAAACTATAGAATATGTCTACAGTTACATCTACCTAGGTATACAAATATCATTTTTAAAAACGCACAATGAAGACGAAATTGAAAGAAGAACAATCATAGCCTGGAAGAAATTTTGGTCACTCAGAGAAATTTTAAAAGGAGACTACTCAATAAACCTTAAGAAAACTGTATTAGACACCTGTATACTGCCTTGTCTACTGTATGGCTGCCAAACTTGGGTATACACGACAAGAGCAAAACAAAGAATTACAACAACACAAAGAGCTATGGAGAGAAGTATCCTAAACATAAGAAAAATTCAAAAAGTCAGGAGCAAAGTAATAAGACAGAAAACAAAGATAACAGATGCCCTCACACAAGCTCTAAAATTGAAATGGCAGTGGGCAGGTCACGTATTGAGATACACAGACACCAGGTGGACAGTCAACACTACAATCTGGAAAGGGCCAATTGGCAAAAGAAGGGTAGGGAGACCGAAAAGACGATGGGCTGACGACATAACCGAAATAATAGGAAAGGACTGGCAAACGATCGGCAAGGACAGAGATCAGTGGAAAGGACTGGAGGAGGCCTTCACCCGAGATGAGGGGTCCACATCCAATAACAAAAATTAA
Protein
MEQVMTALLSIQKELDEQKKLIHKKGEEVTEKVTLNINKILEEKLKNLEEKHENLKSRVENQEQRLYYMERQSRQRNLVFFGLEEHEKSYSNLENTIVDFVHKYFPIQIDHKDLQAIRRIGKRTKKPRPIVITFTTLGKKIDILKGKGALKETPYYIKEDYPQSVLQKRKELQEQVIAEREKGNKAIIKYDKLVLLNNSSKDPKNNKRNLSESPENNTINHAGQISQANKKNKTLAAHIIQRSLSSIHRYLELNNALKDIKCDILGLSETRKMGCHIEEYSDYVFCYIGETKGLYGVGFLIKKAWKNDITNFTGISERVALLQMNFGGLDISIIQAYAPTEKSDDTEIQKFYNDLKKAHTLSNEKIIILGDFNAKIGQPKKEEKLVMGQYGLGQRNERGERLLEYALEYRLAIINTYFKKRPSRRWTWKSPDEKVKNEIDYIMTNVPKIVQNYEVLNNVKFQTDHRLLRATVLLSQAKKNRKGFKPPPKIPKNEEETRYYIDSLKSNIETKLADTRNVQSYYDALEIAITKSLTSKNNTKKEKRHKIFSEETLALINKRSELTLRKNKDADTKKELSKLYKETSKAIKRDYSKHRQRIITEKLNKFRSTKRAFKELNLRKTWIQKLEGQHKEITTRQEIVQKATSFYQELYKNKNKTIKEANDSHNCYNTETIRPIEEKDTYAQLKHLKSDKSPGPDAITNEALKIGAPVLLKPLTELFNLILEAEIVPIQWCTSDIILLYKKGNPLDINNYRPISLLANIYKIFSSIILKRITQEIEKAQPIEQAGFRSGFSTLDHIQALEQVIEKYEEFNKPLYLGFIDYSKAFDSISHNSIWKSLKKLNINSKYLNIIKYIYNNSISYVKLESRGDAINIERGVRQGDPLSPKLFIAVLEDVFRNTDWKNRGIKINNRYLSHLRFADDIVMLSETANELQDMLRSLVQASSQVGLEMNATKTKIMTNSIERPINVKGKTIEYVYSYIYLGIQISFLKTHNEDEIERRTIIAWKKFWSLREILKGDYSINLKKTVLDTCILPCLLYGCQTWVYTTRAKQRITTTQRAMERSILNIRKIQKVRSKVIRQKTKITDALTQALKLKWQWAGHVLRYTDTRWTVNTTIWKGPIGKRRVGRPKRRWADDITEIIGKDWQTIGKDRDQWKGLEEAFTRDEGSTSNNKN

Summary

Catalytic Activity
GTP = 3',5'-cyclic GMP + diphosphate
EC Number
4.6.1.2
EMBL
ODYU01008249    SOQ51673.1    FJ265563    ADI61831.1    FJ265562    ADI61830.1    + More
ODYU01004088    SOQ43598.1    FJ265564    ADI61832.1    FJ265561    ADI61829.1    KZ149907    PZC78256.1    GBBI01004876    JAC13836.1    GBGD01000380    JAC88509.1    FJ265549    ADI61817.1    FJ265542    ADI61810.1    FJ265550    ADI61818.1    FJ265544    ADI61812.1    FJ265545    ADI61813.1    FJ265551    ADI61819.1    FJ265543    ADI61811.1    JARK01001655    EYB84321.1    JARK01000173    EYC41342.1    JARK01000388    EYC37469.1    JARK01001370    EYC16150.1    JARK01001500    JARK01001343    EYB95040.1    EYC28825.1    GL379822    EGT48339.1    JARK01001348    EYC25048.1    EYC25050.1    JARK01001568    EYB89432.1    EYC25049.1    JARK01001676    JARK01001446    JARK01001433    EYB83199.1    EYC01126.1    EYC02928.1    JARK01001473    EYB97806.1    JARK01001424    EYC04317.1    EYC04314.1    JARK01001337    EYC34625.1    JARK01001565    EYB89683.1    EYC04315.1    EYC25046.1    EYC04316.1    QFQQ01000179    PZR20596.1    JARK01001338    EYC33297.1    JARK01001389    EYC11015.1    JARK01001639    EYB85201.1    EYC25145.1    JARK01001354    EYC21986.1    JARK01000460    EYC36749.1    JARK01001340    EYC30828.1    JARK01001353    EYC22263.1    JARK01001621    EYB86109.1    JARK01001359    EYC20105.1    JARK01001438    EYC02111.1    JARK01001626    EYB85833.1    EYC16376.1    JARK01001700    JARK01001393    EYB82228.1    EYC10181.1    JARK01001711    EYB81734.1    JARK01001543    EYB91356.1    JARK01001736    JARK01001462    JARK01001379    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    AF054983    AAC72298.1    JARK01001730    EYB81048.1    JARK01000314    EYC38488.1    EYC31464.1    EYC10025.1    GBBI01004877    JAC13835.1    JARK01001349    EYC24520.1    GDKW01001596    JAI54999.1    JARK01000347    EYC38051.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07714   Pkinase_Tyr
PF00211   Guanylate_cyc
PF01094   ANF_receptor
PF03372   Exo_endo_phos
PF00069   Pkinase
PF00201   UDPGT
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR029052   Metallo-depent_PP-like       
IPR011009   Kinase-like_dom_sf       
IPR001170   ANPR/GUC       
IPR001245   Ser-Thr/Tyr_kinase_cat_dom       
IPR001828   ANF_lig-bd_rcpt       
IPR029787   Nucleotide_cyclase       
IPR000719   Prot_kinase_dom       
IPR001054   A/G_cyclase       
IPR028082   Peripla_BP_I       
IPR017441   Protein_kinase_ATP_BS       
IPR008271   Ser/Thr_kinase_AS       
IPR002213   UDP_glucos_trans       
SUPFAM
SSF56219   SSF56219        + More
SSF53822   SSF53822       
SSF55073   SSF55073       
SSF56112   SSF56112       
Gene 3D

Ontologies

Topology

Length:
1174
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.13367
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00004
outside
1  -  1174
 
 

Population Genetic Test Statistics

Pi
163.592001
Theta
18.376307
Tajima's D
1.200369
CLR
1.077943
CSRT
0.719814009299535
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号