SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14749
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.029 Nuclear   Reliability : 1.88
 

Sequence

CDS
ATGCGTCGCTTACAGCGGGAGGTCAAATCCCGCTTAAGCGACGCCCGAAACGAAAACTGGGATAGTTATTTAGAAGAACTCGCGCCCACTCACCAAGCATACTGGCAACTAGCTAGGACCCTCAAGTCCGAAACTATAGCCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAACCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTCGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTCAAGGAGGCGATCGATAGCCTACAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAATTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATATTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAACAAAATTCTGATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGTATATCAACGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATTAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCTCTCCCGACTAGGCGCGTCAACACCCCCGCCCCCGCCGTTCGCCCAATCACGATGTACGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATCAAGACGGTACGCGATCGTGCCGCCTTCATCCTAGGACGCCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCATACACTTAAAATCCTTTCAAATTATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTTAG
Protein
MRRLQREVKSRLSDARNENWDSYLEELAPTHQAYWQLARTLKSETIATMPPLVRPSGQPPAYDDDDKAELLADALQEQCTTSTQHADPEHTEFVDREVERRASLPPSDALPPITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNTPAPAVRPITMYDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARIHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESIS

Summary

EMBL
AB018558    BAA76304.1    U07847    AAA17752.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    KQ459259    KPJ02068.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    KQ971729    KYB24751.1    GGMR01019198    MBY31817.1    GALX01005359    JAB63107.1    ABLF02029306    ABLF02029314    ABLF02060138    GALX01005299    JAB63167.1    ABLF02014862    ABLF02014866    ABLF02061908    RPOV01000134    RPJ78669.1    ABLF02003961    ABLF02059872    ABLF02042518    ABLF02057746    S59870    AAB26437.2    KK117880    KFM71667.1    GFTR01008038    JAW08388.1    ABLF02033757    GBBI01004571    JAC14141.1    GBBI01004395    JAC14317.1    GGMR01018716    MBY31335.1    ABLF02008933    GGMS01008766    MBY77969.1    NEVH01006736    PNF36716.1    GGMS01000737    MBY69940.1    GGMR01003407    MBY16026.1    GGMS01004685    MBY73888.1    GGMR01016114    MBY28733.1    GGMS01002992    MBY72195.1    NEVH01006721    PNF37225.1    JXUM01155316    KQ572171    KXJ68070.1    GGFJ01002256    MBW51397.1    GGFJ01002257    MBW51398.1    GEZM01038405    JAV81653.1    GFXV01007093    MBW18898.1    NEVH01020940    PNF20481.1    NEVH01026386    PNF14434.1    GGFJ01001842    MBW50983.1    GGFJ01001844    MBW50985.1    GGFJ01001843    MBW50984.1    ABLF02024246    GGMS01006359    MBY75562.1    GBBI01001646    JAC17066.1    NEVH01005938    PNF38077.1    JRES01000644    KNC29657.1    GGFL01004957    MBW69135.1    GGFL01005012    MBW69190.1    NEVH01007443    PNF35684.1    NEVH01018383    PNF23463.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01003017    PNF40781.1    GEZM01053022    JAV74219.1    NEVH01010546    PNF32261.1    GGMS01012005    MBY81208.1    GBYB01008290    JAG78057.1    NEVH01023962    PNF17612.1    NEVH01020071    PNF21969.1    NEVH01007393    PNF35987.1    NEVH01012089    PNF30491.1    NEVH01000280    PNF43672.1    GGMS01002955    MBY72158.1    NEVH01001355    PNF42855.1    NEVH01023961    PNF17613.1    NEVH01007578    PNF35646.1    KQ973412    EFA12510.2    GGMR01000676    MBY13295.1    GFDF01007661    JAV06423.1    LBMM01014395    KMQ85192.1    NEVH01019964    PNF22161.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    NWSH01000032    PCG80497.1    NEVH01017559    PNF23833.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    NEVH01007838    PNF34986.1    JXUM01014072    KQ560393    KXJ82651.1    GFXV01006424    MBW18229.1    NEVH01006754    PNF36554.1    GGMR01012305    MBY24924.1    NEVH01014858    PNF27387.1    AF012049    AAC24972.1    NEVH01002716    PNF41415.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    NEVH01016302    PNF25823.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GGFJ01001858    MBW50999.1    GGMR01000005    MBY12624.1    NEVH01011985    PNF31054.1    LBMM01010106    KMQ87671.1    GFTR01008262    JAW08164.1    KK119692    KFM76444.1    GGFJ01001857    MBW50998.1    NEVH01019080    PNF22876.1    GFTR01008279    JAW08147.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF10551   MULE
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.00196922,     Score=99

Ontologies

Topology

Length:
548
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
4.94726999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.20581
outside
1  -  548
 
 

Population Genetic Test Statistics

Pi
126.222479
Theta
13.612281
Tajima's D
5.106053
CLR
0
CSRT
0.999950002499875
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号