SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14730
Pre Gene Modal
BGIBMGA004212
Annotation
hypothetical_protein_OBRU01_05243_[Operophtera_brumata]
Location in the cell
Nuclear   Reliability : 3.272
 

Sequence

CDS
ATGAAAGCAATAAATCGTAACGAAGCAACAGAGTACGCTAGCGGTCCCATATTGACCATCTTGGATACGGAACAAGATGAAAGAACCAGATGGAAGAGAACTCAGAAAACTTTTGAAGACATTTGGAAGAGGTGGCAATCCGAATATCTCGCTCAACTCTCAACGAGGAGCAAATGGCAAAGACCTCATGAAAATGTACGAGTTGATGACGTCGTCATCATTCATGAGCCTAACCTTCCCGCAGGAAGATGGGCTCTAGGCAGAGTCACTGAGCTTCATCCCGGCTCCGATGGACTGGTCCGGGTAGTTACCCTGAAAACAAAAACTGGGTATATCAAGCGCCCAGTGATTAAACTATCAGTGTTGGTATCTAACCCGAAAGCAACCGATCAGGCAGGGAAGATATCAGACAAACAAACAATCAAGAAGAAGGATGACCTATCAAAATTTCGACCTGGAACGGTGTCAAATTTGATAGCAACTCTCATTACACTATTCCTTTTTATGACGTCAGTTTTTGGCCACCAGCAACCAACATCTCCATATAGTTTGACAACGATTCACAAAGCACTATATTTTGACCGAATCTCGAGCGTGCAATTTATACAAGATGAATGGAAACTCATCGTGTATCACGACATGAGCCCTTATTGGGACGGTTCAGAAACCTTCAAGAAATACCTTCAACAAATAACCAACGTGTGCGAAAGAGAGACAAACAAGGCACTATGTGACATTATCATACTACAACTACGTCATGCTCATGACGAACTAAAGTACTACAACGAAATGTTAATGAATCAGCATGTCGAAGAACGCACACGGAAGAGACGAGGCCTCATCGACGGTGTGGGCTATGTTGCTAACAGTTTATTTGGAGTTTTGGATCAACGTTTCGCCGATCAATACAAGCAGGATATTTCTCTTATAAAAAGAAATGAAGAACACTTAGGACTCCTGTGGAAAAATCAGACCTCAGTTGTAGAAGCGGAATATAATTTACTCAAAAGAACTGAGGAATCGATCAATCGGCAACACAAAGTAATTAATCAACATTTAAACAATTTAACGAAGGCCACTAACATTTTGAACAAAAATCTGCAGGAACAAGAAGTGATGAACGAGCTAGCACTCTCCACAATCATAGCTACAAATATGCTCGCGAAGCTAAAATCGATACAAGATACAATAATCGACACGATAACAGATATCCATCATGGATTATTCAATGTCCATTTACTATCGCCGAAGCAATTACAAGATCAACTCCGCATTATTTCGGGACAATTATCGCGAGAGCTATCCTTACCGATGGAAAACATACAGTCGGAACTACCCAAAATTTATCATCTTCTGAAGGTCAAAGCAAGGATTACTGCAATACAAGTCGCTAAAGCCGGGGTCATTACACTGGATTCTGATTGCGTAATTAAAGGCGAAGACTTCACCGTTTTTTCACATAAACCACTACACTCAGAGGTTAAAACTGCGACTGACTTGGAATCACAGCAAATAGCACCGATCAATCACATCATCAACGTCTCTGTGCCAGAACTTGAATTCAACATCACCGATCACCAAGCTTCATTTCGGCACATTAAGGAACAGATTGAGGAGATGAAGGCAGAAAAGGCTTTGTACTCTGAAATATCAAGCCATGACATACATCAATATTCAGTAATCTACGTGTTGGTTTTGGGTGCTGTGTTGACAGTAATAGTTTTCCTTTGTCGGTGGTTTTATCGTCGTCGGCAGAGGAGCGCCGACTTAGAGTCGGACTCCGAGATGCAGCCTCCAAAGGTGCCGGCGCGCAGAGGGTTTGCCACCTCCGTCGTCGGTACGACGCCACACACAAGAGACGCAAATCATCAGTCGCGAGAAGAGACCGTTGAATTGAGGAATTTTAATAGCATATTCAGCAGCATAAAGCGGCACGAGAAAACACCTCCAGTGCTTACCAAACCAGTGTCTACTGACAGTGACTGA
Protein
MKAINRNEATEYASGPILTILDTEQDERTRWKRTQKTFEDIWKRWQSEYLAQLSTRSKWQRPHENVRVDDVVIIHEPNLPAGRWALGRVTELHPGSDGLVRVVTLKTKTGYIKRPVIKLSVLVSNPKATDQAGKISDKQTIKKKDDLSKFRPGTVSNLIATLITLFLFMTSVFGHQQPTSPYSLTTIHKALYFDRISSVQFIQDEWKLIVYHDMSPYWDGSETFKKYLQQITNVCERETNKALCDIIILQLRHAHDELKYYNEMLMNQHVEERTRKRRGLIDGVGYVANSLFGVLDQRFADQYKQDISLIKRNEEHLGLLWKNQTSVVEAEYNLLKRTEESINRQHKVINQHLNNLTKATNILNKNLQEQEVMNELALSTIIATNMLAKLKSIQDTIIDTITDIHHGLFNVHLLSPKQLQDQLRIISGQLSRELSLPMENIQSELPKIYHLLKVKARITAIQVAKAGVITLDSDCVIKGEDFTVFSHKPLHSEVKTATDLESQQIAPINHIINVSVPELEFNITDHQASFRHIKEQIEEMKAEKALYSEISSHDIHQYSVIYVLVLGAVLTVIVFLCRWFYRRRQRSADLESDSEMQPPKVPARRGFATSVVGTTPHTRDANHQSREETVELRNFNSIFSSIKRHEKTPPVLTKPVSTDSD

Summary

Pfam
PF18701   DUF5641        + More
PF12259   Baculo_F
Interpro
IPR022048   Envelope_fusion-like        + More
IPR040676   DUF5641       

Ontologies

Topology

Length:
661
Number of predicted TMHs:
2
Exp number of AAs in TMHs:
42.93303
Exp number, first 60 AAs:
0
Total prob of N-in:
0.94639
inside
1  -  152
TMhelix
153  -  175
outside
176  -  557
TMhelix
558  -  580
inside
581  -  661
 
 

Population Genetic Test Statistics

Pi
418.403604
Theta
208.571882
Tajima's D
3.210278
CLR
0.000802
CSRT
0.986350682465877
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号