SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14725
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.874
 

Sequence

CDS
ATGGCGTGCAACGCGAGATTAAAACCCCATTCCTTGAAGTTAGCATTCTACAATGCTAACGGACTCGCGCGTCAGCGCGACCAGGTTTATGAGTTTCTACGTGACAATCTCATCGACATCCTTCTGGTGCAGGAGACCTTCCTAAAGCCCTCGCGTCGCGACCCCAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCTCCACCCGCAAGGGCGGGACTGTCATTTACTATAGGAGGGCCCTGCACTGCGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGCATCGCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCTGACAAACCCCTCCTGAGCAGTGACCTCGAGACACTGCTCGGTATGGGGGACGCGGTCATTCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGCACGAATGTGAACGGTAGGCGTCTCGACGCGTTCATAGACGACCTCACATTCGAGATATTCAACCCTCCGACCCCCACGTGCTATCCGTACAACGCCGCGCGTCGTCCGAGCACAATAGATCTGGCACTGCTGAGGAACGTAACTCTGCGCTTGCGCTCCATCGAGGCAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGACACCGTCGAATCCATAAACATCTTCACTGATCACGTCTCGACGGCGATCACAAGATCTTCAAAGCAAGTCGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGATCTTAGGGACCTCGTAAGAGTTAGAAACGCGGCAATCCGGGCCTACGATCGATATCCCACGGATTCAAACCGGACTCGGATGCGTCGCTTACAGCGGGAGGTCAAATCCCGCTTGAGCGACGCCCGAAACGAAAACTGGGATAGTTATTTAAAAGAACTCGCGCCCACTCACCAAGCATACTGGCGACTAGCTAGGACCCTCAAGTCCGAAACTATCGTCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAACCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTCGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTTAAGGAGGCGATCGATAGCCTACAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAATTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATACTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAATAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAACAAAATTCTGATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGGCTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGTATATCAACGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCTACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGA
Protein
MACNARLKPHSLKLAFYNANGLARQRDQVYEFLRDNLIDILLVQETFLKPSRRDPKVANYVMVRNDRLSTRKGGTVIYYRRALHCVPLDTPSLLHIEASVCRIALTGHQPIVIASVYLPPDKPLLSSDLETLLGMGDAVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIFNPPTPTCYPYNAARRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESINIFTDHVSTAITRSSKQVDVEDCFHRIRLSPDLRDLVRVRNAAIRAYDRYPTDSNRTRMRRLQREVKSRLSDARNENWDSYLKELAPTHQAYWRLARTLKSETIVTMPPLVRPSGQPPAYDDDDKAELLADALQEQCTTSTQHADPEHTEFVDREVERRASLPPSDALPPITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPNNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTARKAPPSPRYYSVCISTIYPGLRRPIWRSSPMTPPSTTRVGRRRCFIDDFRPQLPPWDSGSGSGASTSTLRKAQRCSSKGVALRTPR

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
AF081103    AAC72921.1    KQ459265    KPJ02064.1    KQ973342    KXZ75569.1    GEZM01008457    JAV94772.1    KQ973412    EFA12510.2    KQ971729    KYB24751.1    GBBI01004395    JAC14317.1    GGMS01006359    MBY75562.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    GGFL01005012    MBW69190.1    GGMR01018716    MBY31335.1    GGFL01004957    MBW69135.1    S59870    AAB26437.2    L79944    AAB04627.1    GALX01005299    JAB63167.1    NEVH01006736    PNF36716.1    GGMR01002322    MBY14941.1    GGMR01015412    MBY28031.1    GGMS01002992    MBY72195.1    GBBI01004571    JAC14141.1    AJWK01012157    GGMR01004661    MBY17280.1    KK119692    KFM76444.1    GGFJ01001844    MBW50985.1    GGMR01013409    MBY26028.1    GEDC01029594    JAS07704.1    GGFJ01001843    MBW50984.1    GGFJ01001842    MBW50983.1    ABLF02023911    NEVH01011985    PNF31054.1    NEVH01021205    PNF19912.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    NNAY01003095    OXU19992.1    GGMR01012443    MBY25062.1    GGMR01016297    MBY28916.1    ABLF02034467    NEVH01005277    PNF39135.1    KK118005    KFM71947.1    ABLF02040174    ABLF02040183    ABLF02055266    GGMS01017365    MBY86568.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GGMR01012305    MBY24924.1    GGMR01006408    MBY19027.1    GGMS01002786    MBY71989.1    GGMR01003407    MBY16026.1    KK115285    KFM64681.1    GFTR01008262    JAW08164.1    GALX01005359    JAB63107.1    ABLF02042385    GFTR01008279    JAW08147.1    KF280391    AIE77315.1    GGMR01000226    MBY12845.1    GGMR01016905    MBY29524.1    NEVH01017470    PNF24199.1    KK119261    KFM75202.1    NEVH01023280    PNF18085.1    KQ973363    EFA13335.2    NEVH01016302    PNF25823.1    ABLF02042518    ABLF02057746    GFTR01008271    JAW08155.1    GFTR01008269    JAW08157.1    GGFL01005122    MBW69300.1    GGFL01005121    MBW69299.1    GGMS01006655    MBY75858.1    GEZM01084970    JAV60359.1    NWSH01007753    PCG62823.1    GFTR01008254    JAW08172.1    KK113281    KFM59799.1    GBGD01000389    JAC88500.1    GGMR01000676    MBY13295.1    M38437    GFTR01008038    JAW08388.1    GEZM01084969    JAV60363.1    GEHC01000968    JAV46677.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
737
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.749699999999999
Exp number, first 60 AAs:
0.00032
Total prob of N-in:
0.00205
outside
1  -  737
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.243645
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号