SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14723
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.299
 

Sequence

CDS
ATGGAAGAAGAGCTCTTAGGGTTTCTCGGGTTACTTGCCGAGAAGTACCCGGTGTTATCCAACCTCACGGCCGAATTCGCGGCTTACAGGGCCGCCCGCGCAAGTTCCCCCCCGCCCGCGTCCCTCGCCGCGTCGTTCAAAGCCGCGCAAACATGCCCCGCCCCCAAATCCATTTCGAGCGCACGTATTCACGTAGCGACTCATGAAGCGCCTAGCGCCAACGAGGCGCCTAACGCACCCGCGACGTTTACACCGATCTCGTCCGTCGCGTCGTCAATCGCCAACTCCGGTTCAGACTCCGATACCGGATCGGAGATGGACTTCGAGTCCGCGACGAGCCCGCAGCCTGGAACCTCCGATGGGTTCAAAACAGTCACGCGTGCCAAAAAACGCGCCCGGGCCGTGGAACCGTCCACGGCGCCAAAACAGCCCAAGGCCGCGAACGCGTCGCGTCCTAAAGTCGTGGTCTCACCCGACTGCCCTCGCCGCGCAACTCCGTCGCCGAAACCCGCGCCCGTCAATAAAATCGTCGCGCCCCCGCCCGTAATCCTACGCGAAAAATCCGCGTGGAACCGGGTATCTCAGGCCCTTACGGCCAACAAAATCAACTACTCCCAAGCGCGTAATCTCGCGCACGGGATTCAAATAAAGGTCGCAACGCCGGGCGACCATAGGGCCCTCACTTCTTACCTCCGAAAGGAGAGCATAGGATACCACACCTATGCACTCCAGGAGAACCGCGAGCTCCGCGTAGTAATACGCGGAGTACCAAAAGAGCTCGACGTCGAGCTAATCAAAGAAGATTTAATCAGACAAGCGTACCCGATAGTAAGTGTGCACCGTATGCACAGCGGGCGCGATAAATTCGCGTATAACATGGTTCTCGTCGCGTTGGAACCAACCGCCGAAGGCAAACGAATTGCCTCAAGCCTCCGCACCGTTTGCGGGTTATCAGGGGTCACCGTCGAGGCCCCACACAAAAAAGGCACTCCCGGTCAGTGCCATAGGTGCCAACTGTATGGCCACTCCGCGCGCAACTGCCACGCGCGTCCGCGGTGCGTAAAGTGCCACGGTGACCACGCGACAGCCGACTGTTCGCGGGTCAAAGAGACCGCGACCGAACCTCCGAGCTGTGTGCTCTGCCAGAAGCAGGGCCACACAGCCAACTACCGCGGATGCCCCAAGGCCCCGCGGAAGCGTCTGGCCAACGCGCCATCTAAAACCGTCGGCCCCAAGACTTCGGCGCCCCGCGCGCCGAAACCTGCCTTCGTGCCGGCACCGGTGCCCACCGTCTCCGCGTGGGCAAAACCGCTGCCGCTCACGTTGGCAGGGAAACCACCGGCACCCCAGCCCCTGCTCGCGCCGCGCCCCGCCCTCGCGCCCGGTCCCGCGCCTCGCCCCGGCCCCGCGCGGCCTGCCGTAAACGACTTTTCAATCGTGCGTGATTATATCGCCGCGATAAATATAGATCGCATGCGCTCGTTCGCCGACGCCATGCGCAGGGCAGTCACGGCCGATGACCGCCTATACGCGACGTTCGACCATATGGACGTCATCGAGTCCCGCGATCAAGTATATGAGTTTCTCCGTGACAATCTCATCGACATCCTTCTGGTGCAGGAGACCTTCCTAAAGCCCTCGCGTCGCGACCCCAAAGTCGCGAATTACGTCGTGGTTAGGAATGACAGACTCTCCGCCCGCAAGGGCGGGACTGTCATTTACTATAGGAGGGCCCTGCACTGCGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGCATCGCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCTGACAAACCCCTCCTGAGCAGTGACCTCGAGACACTGTTCGGTATGGGGGACGCGGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGCACGAATGTGAACGGTAGGCGTCTCGACGCGTTCATAGACGACCTCACATTCGAAATATTCAACCCCCCGACCCCCACGTACTATCCGTACAACACCGCGCGTCGTCCGAGCACAATAGATCTGGCACTGCTGAGGAACGTAACTCTGCGCTTACGCTCCATCGAGGCAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGATACCGTCGAATCCATAAACATCTTCACTGATCACGTCTCGACGGCGATCATAAGATCCTCGAAACAAGTCGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGATCTTAGGGACCTCGTTAGAATCAGAAACGCGGCAATCCGGGCCTACGATCGATATCCCACGGATTCAAACCGGACTCGGATGCGTCGCTTACAGCGGGAGATCAAATCCCGCTTAAGCGACGCCCGAAACGAAAACTGGGATAGTTATTTAGAAGAACTCGCGCCCACTCACCAAGCATACTGGCGACTAGCTAGGACCCTCAAGTCCGAAACTATAGCCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAATCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAACAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACAGAGTTCGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTTAAGGAGGCGATCGATAGCCTACAACCACGGAAAGCTCCCGGCTCCGACGGTATCCGCAACCGCGCGCTTAAATTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATATTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTTTACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAATAAAATTCTTATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGTATATCAACGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATTAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCTCTCCCGACTAGGCGCGTCAACACCCCCGCCCCCGCCGTTCGCCCAATCACGATGTTCGACCAGCCCATACCGTGGGCCCCGAAGGCCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATCAAGACGGTACGCGATCGTGCCGCCTTCATCCTAGGACGTCTCTACCCGATGATATGTAGGCGAACCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTTCAGTCGGCGTCCATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATACTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTCCCGATCCACTAACGGTGCTTTTAGGCACTCCCCCCCTTGTTGCTGGTAAAGCGCAGGGGGTGAACTCCTACTCAGGGGACTCGCCTTTCGGCGAGTGTGCCTTAAGTCCCGGGGACGCCCCCCCCGGGCACAGAACAACCATGAATAACGCGAACAGCGCGCTATTCGCGCAATTCGTACAACAAATATGCCCGGACATCATGTCCCGTTTTGAGGCCTACAAGGCCACGCTAGCATCGAACCCCGACGATTCGTCCGCCGCCGCCGCGATAATCCGAGACTCTCCACTGTCGCCTCCCGCGCCGGTACTCCGCGACTCGCCGATGTCGCCCCCCACCCCCGCGCCCGCGTCGATCGCGTCATGCGCGGCATCGAGCTCCGGCTCCGACTCCGAGTCGGAGATGGAGTTCGAGTCGGCCGCCAGCCCCGAACCCGGAACCTCCGATGGGTTCCAAACCGTCACGCGCGGAAAGAAACGCGCCCGCGCCGTGGAACCGTCCGCGGCGCCGAAACAACCCAAGGCCGCGAACGCGTCGCGGCCTAAAGTCGTGGTCTCACCCGACTCCCCTCGCCGCGCAACCCCGTCGCCGCGACCCCAACCCGCGTCCGTCCGCAAAATTCCCGCGCCGCCGCTGGTAATTTTACAAGATAAGACCGCGTGGGATCGCGTATCCCGTGCCTGTAAGGCACAAAACGTTAACGTCGTCCATGCGCGTAACATCGCGCACGGCATACAGATCAAGACGGCCTCACCGGACGATCACAGGGCGCTGACAGCCCACCTCCGAAAGGAGCGCATAAGCTTCCACACTTATGCGCTCCAGGAGGATCGCGAGCTCCGCGTAGTAATACGCGGAGTACCGAAGGAGCTCGACGTCGAGCTGGTCAAGGAGGACCTCATCGGGCAGGCGTACCCGATTGTAAGCGTGCACCGAATGCACAGCGGGCGCGACAAATTCGCGTATAATATGGTTCTCGTCGCGTTGGAACCAACCGCCGAAGGCAAACGAATTGCCTCAAGCCTCCGCACCGTTTGCGGCTTATCCGGGGTCACCGTCGAGGCCCCATATAGAAAAGGCACTCCCGGGCAGTGCCACCGCTGCCAGCTGTACGGCCACTCCGCGCGCAACTGCCACGCGCGTCCGCGGTGCGTAAAGTGCCTCGGTGACCACGCGACAGCCGACTGTTCGCGGGTCAAAGAGACCGCGACCGAACCTCCGAGCTGTGTGCTCTGCCAGAAGCAGGGCCACACAGCCAACTACCGCGGATGCCCCAAGGCCCCGCGGAAGCGTCTGGCCAACGCGCCTCCAAAAACCGTCGGCCCAAAGACTTCGGCGCCCCGCGCGCCGAAGCCTGCCTTCGTGCCGGCACCGGTGCCCACCGTCTCCGCGTGGGCAAAACCGCTGCCGCTCACGCTGGCAGGGAAACCACCGGCACCCCAGCCCCTGCTCGCGCCGCGCCCCGCCCCCGCGCCCGGTCCGCGCCTCGCCCCGGCCCCGCCCGGCCAGCCGTTAACGACTTTTCAATCGTGCCGCGATCAAGTATATGAGTTTCTCCGTGACAATCTCATCGACATCCTTCTGGTGCAGGAGACCTTCCTAAAGCCCTCGCGTCGCGACCCCAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCTCCGCCCGCAAGGGCGGGACTGTCATTTACTATAGGAGGGCCTTGCACTGCGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGCATCGCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCTGACAAACCCCTCCTGAGCAGTGACCTCGAGACACTGCTCGGTATGGGGGACGCGGTCATCCTGGCAGGCGACTTAAATTGCCACCACACTAGGTGGAACTGCCATCGCACGAATGTGAACGGTAGGCGTCTCGACGCGTTCATAGACGACCTCACATTCGAAATATTCAACCCCCCGACCCCCACGTCCTATCCGTACAACGCCGCGCGTCGTCCGAGCACAATAGATCTGGCACTGCTGAGGAACGTAACTCTGCGCTTACGCTCCATCGAGGCAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGATACCGTCGAATCCATAAACATCTTCACTGATCACGTCTCGACGGCGATCATAAGATCCTCGAAACAAGTCGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGATCTTAGGGACCTCGTTAGAATCAGAAACGCGGCAATCCGGGCCTACGATCGATATCCCACGGATTCAAACCGGACTCGGATGCGTCGCTTACAGCGGGAGGTCAAATCCCGCTTAAGCGACGCCCGAAACGAAAACTGGGATAGTTATTTAGAAGAACTCGCGCCCACTCACCAAGCATACTGGCGACTAGCTAGGACCCTCAAGTCCGAAACTATAGCCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAATCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTCGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTCAAGGAGGCGATCGATAGCCTACAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAACTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATATTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAATAAAATTCTTATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCATATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCACCCTCTCCCCGTTACTATTCAGTTTGTATATTAACGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGCAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATTAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCCCTCCCGACTAGGCGCGTCAACACCTCCGCCCCCACCATTCGCCCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGATAGCTGTCGGAGCCCCGTGGTTCGTCAGGAATGTCGACCTCCATGACGACGCGGACTTAGAGTCCATCAGTAAGTATCTGCAGTCGGCGTCCATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTCCCGATCCACTAACGGTGCTTTTAGCGGGCGGCGACAAATTCGCGTATGATATGGTGCTCGTAGCACTCGAACCCACACCGGAGGGCAAGAAAATTGCCTCATGTCTCCGCACCGTGTGCGGCTTATCGGGGGTCACCGTAGAGGCCCCCTACAAACGCGGCACTCCCGGGCAGTGCCATCGTTGCCAGCTCTATGGCCACTCCGCGCGTAACTGCAACGCGCGACCGCGTTGCGTGAAATGTCTAGACGATCACGCGACCACCGACTGCTCGCGCGTAAAGGAGACAGCGACGGAGCCGCCGAGCTGTGTACTCTGCCGCAAGCAGGGACACACGGCCAACTACCGTGGATGCCCCAAGACTCCACGGAAGCGCCCGGCAAACGCGCCCCCCAAAACCGCTGGCCCAAAGACTTCGGCGCCCCGCGCGCCGAAACCGGCTTTCGTACCGGCTCCGGTGCCCACCGTCTCCGCGTGGGCGAAACCGTTGCCGTTCACGAAGGCAGGAACGACACCGGCACCCCAACCGCGGTACGCGCCGCAACCTCTACTCGCGCCGCGCCCCGCCCCCGCGCCCGGTCCCGCGCACTCAAACGACTTTACGATTATTCGCGACTACATCGCCGCGATAAACATCGACCGCATGCGTTCATTCGCCGACGCCATGCGCAGAGCGGTCACGGCCGAAGACCGCCTAAACGCGACGTTCGAATACATAGACGTCATCGAGTCCGTCCAGCGCACGCTGCGCGACCAGGTTTATGAGTTTCTACGTGACAATCTCATCGACATCCTTCTGGTGCAGGAGACCTTCCTAAAGCCCTCGCGTCGCGACCCCAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCTCCACCCGCAAGGGCGGGACTGTCATTTACTATAGGAGGGCCCTGCACTGCGTCACTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGCATCGCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTATATCTCCCTCCTGACAAACCCCTCCTGAGCAGTGACCTCGAGACACTGCTCGGTATGGGGGACGCGGTCATTCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGCACGAATGTGAACGGTAGGCGTCTCGACGCGTTCATAGACGACCTCACATTCGAGATATTCAACCCTCCGACCCCCACGTGCTATCCGTACAACGCCGCGCGTCGTCCGAGCACAATAGATCTGGCACTGCTGAGGAACGTAACGCTGCGCTTGCGCTCCATCGAGGCAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAAGCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCGAGGACACCGTCGAATCCATAA
Protein
MEEELLGFLGLLAEKYPVLSNLTAEFAAYRAARASSPPPASLAASFKAAQTCPAPKSISSARIHVATHEAPSANEAPNAPATFTPISSVASSIANSGSDSDTGSEMDFESATSPQPGTSDGFKTVTRAKKRARAVEPSTAPKQPKAANASRPKVVVSPDCPRRATPSPKPAPVNKIVAPPPVILREKSAWNRVSQALTANKINYSQARNLAHGIQIKVATPGDHRALTSYLRKESIGYHTYALQENRELRVVIRGVPKELDVELIKEDLIRQAYPIVSVHRMHSGRDKFAYNMVLVALEPTAEGKRIASSLRTVCGLSGVTVEAPHKKGTPGQCHRCQLYGHSARNCHARPRCVKCHGDHATADCSRVKETATEPPSCVLCQKQGHTANYRGCPKAPRKRLANAPSKTVGPKTSAPRAPKPAFVPAPVPTVSAWAKPLPLTLAGKPPAPQPLLAPRPALAPGPAPRPGPARPAVNDFSIVRDYIAAINIDRMRSFADAMRRAVTADDRLYATFDHMDVIESRDQVYEFLRDNLIDILLVQETFLKPSRRDPKVANYVVVRNDRLSARKGGTVIYYRRALHCVPLDTPSLLHIEASVCRIALTGHQPIVIASVYLPPDKPLLSSDLETLFGMGDAVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIFNPPTPTYYPYNTARRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESINIFTDHVSTAIIRSSKQVDVEDCFHRIRLSPDLRDLVRIRNAAIRAYDRYPTDSNRTRMRRLQREIKSRLSDARNENWDSYLEELAPTHQAYWRLARTLKSETIATMPPLVRPSGQSPAYDDDDKAELLADALQEQCTTSTQHADPEHTEFVDREVERRASLPPSDALPPITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNTPAPAVRPITMFDQPIPWAPKAKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRTVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPDTADRMESSRRRPKHVISDPPDPLTVLLGTPPLVAGKAQGVNSYSGDSPFGECALSPGDAPPGHRTTMNNANSALFAQFVQQICPDIMSRFEAYKATLASNPDDSSAAAAIIRDSPLSPPAPVLRDSPMSPPTPAPASIASCAASSSGSDSESEMEFESAASPEPGTSDGFQTVTRGKKRARAVEPSAAPKQPKAANASRPKVVVSPDSPRRATPSPRPQPASVRKIPAPPLVILQDKTAWDRVSRACKAQNVNVVHARNIAHGIQIKTASPDDHRALTAHLRKERISFHTYALQEDRELRVVIRGVPKELDVELVKEDLIGQAYPIVSVHRMHSGRDKFAYNMVLVALEPTAEGKRIASSLRTVCGLSGVTVEAPYRKGTPGQCHRCQLYGHSARNCHARPRCVKCLGDHATADCSRVKETATEPPSCVLCQKQGHTANYRGCPKAPRKRLANAPPKTVGPKTSAPRAPKPAFVPAPVPTVSAWAKPLPLTLAGKPPAPQPLLAPRPAPAPGPRLAPAPPGQPLTTFQSCRDQVYEFLRDNLIDILLVQETFLKPSRRDPKVANYVMVRNDRLSARKGGTVIYYRRALHCVPLDTPSLLHIEASVCRIALTGHQPIVIASVYLPPDKPLLSSDLETLLGMGDAVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIFNPPTPTSYPYNAARRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESINIFTDHVSTAIIRSSKQVDVEDCFHRIRLSPDLRDLVRIRNAAIRAYDRYPTDSNRTRMRRLQREVKSRLSDARNENWDSYLEELAPTHQAYWRLARTLKSETIATMPPLVRPSGQSPAYDDDDKAELLADALQEQCTTSTQHADPEHTEFVDREVERRASLPPSDALPPITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSTLSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNTSAPTIRPAHTVGPEGQIFRRHPRQIAVGAPWFVRNVDLHDDADLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLAGGDKFAYDMVLVALEPTPEGKKIASCLRTVCGLSGVTVEAPYKRGTPGQCHRCQLYGHSARNCNARPRCVKCLDDHATTDCSRVKETATEPPSCVLCRKQGHTANYRGCPKTPRKRPANAPPKTAGPKTSAPRAPKPAFVPAPVPTVSAWAKPLPFTKAGTTPAPQPRYAPQPLLAPRPAPAPGPAHSNDFTIIRDYIAAINIDRMRSFADAMRRAVTAEDRLNATFEYIDVIESVQRTLRDQVYEFLRDNLIDILLVQETFLKPSRRDPKVANYVMVRNDRLSTRKGGTVIYYRRALHCVTLDTPSLLHIEASVCRIALTGHQPIVIASVYLPPDKPLLSSDLETLLGMGDAVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIFNPPTPTCYPYNAARRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPLNREPDTRTMVDWKKLGTCLADTAPPSLPCGPDSTPSPRTPSNP

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.00265875,     Score=105

Ontologies

Topology

Length:
3212
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0391200000000001
Exp number, first 60 AAs:
0.01226
Total prob of N-in:
0.00056
outside
1  -  3212
 
 

Population Genetic Test Statistics

Pi
122.65606
Theta
27.869713
Tajima's D
2.173867
CLR
0.169859
CSRT
0.913304334783261
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号