SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14722
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.589
 

Sequence

CDS
ATGAACACGAACAGCGCGCTATTCGCGCAGTTCGTGCAATTAATATGCCCGGACATTATGTCCCGTTTTGAGGCCTACAAGGCCACGCTAGAATCGAACCCCGATGGTTCATCCGCCGCCGCCGCGATTATCATCCGCGACTCGCCGTTATCGCCTCCCGCGCAGGCACTCCGCGACTCGCCGATGTCGCCCCCCACACCCGCGCCCGCGTCGATCGCGTCTTGCGCGGCATCGAGCTCCGGCTCCGACTCCGAGTCGGAAATGGAGTTCGAGTCGGCCGCCAGCCCTGAACCCGGAACCTCCGATGGGTTCAAAACCGTCACGCGCGGGAAAAAACGCGCCCGCGCCGTGGAACCGTCCGCGGCGCCGAAACAACCCAAGGCCGCGAACGCGTCGCGGCCTAAAGTCGTGGTCTCACCCGACTCCCCTCGCCGCGCAACCCCGTCGCCGCGCCCCGGGCCCGCGCCCGTCCGAAAAGTTCCCGCGCCGCCGCCGGTCATCCTGCGGGAAAAGTCTTCTTGGGATCGCGTGTCCCTGGCCCTTAAGGCCCAAAAGATCAATGTCGTCCATGCGAGGAATATCCCGCATGGAATTCAGATCAAGGTAGAAACATCCGACGACCATAGGTCGTTGACCGCGTACCTCCGCAAGGAACGCATAGGGTATCATACCTATGCGCTCCAGGAGGAGCGTGAACTCCGCGTCGTAATACGCGGAGTCCCCAAAGAGCTCGACGTCGAGCAAATTAAGAATGACCTGGTAGGTCAGTCCTACCCCGTCATAAGTGTGCACCGGATGCACAGCGGGCGCGACAAATTCGCGTACGATATGGTGCTCGTAGCACTAGAAGCCACACCGGAGGGCAAGAAAATTGCCTCATGTCTCCGCACCGTGTGCGGCCTATCGGGGGTCACCGTAGAGGCCCCCTACAAACGCGGCACTCCCGGGCAGTGCCACCGTTGCCAACTCTATGGCCACTCCGCGCGTAACTGCAACGCGCGACCGCGTTGCGTGAAGTCCTTAGGCGATCACGCGACCACCGATTGCTCGCGCGTTAAGGAGACAGCGACGGAGCCGCCGAGCTGTGTACTCTGCCGCAAGCAGGGACACACGGCCAACTACCGTGGATGCCCCAAGGCTCCACGGAAGCGCCCGGCAAACGCGCCCCCTAAAACCGCTGGCCCAAAGACTTCGGCGCCCCGCGCGCCGAAACCGGCTTTCGTACCGGCTCCGGTGCCCACCGTCTCCGCGTGGGCGAAACCGTTGCCGTTCACGAAGGCAGGAACGACACCGGCACCCCAACCGCGGTACGCGCCGCAACCTCTACTCGCGCCGCGCCCCGCCCCCGCGCCCGCGCCTCGCCCCGGCCCCGCGCACTCAAACGACTTTACAATTATTCGCGACTACATCGCCGCGATAAACATTGACCGCATGCGTGCATTCGCCGACGCCATGCGCAGAGCGGTCACGGCCGAAGACCGCCTAAACGCGACGTTCGAGTACATCGACGTCATCGAGTCCGTCCAGCACACGCTGCGCGACCAGGTTTATGAGTTTCTACGTGACAATCTCATCGACATCCTTCTGGTGCAGGAGACCTTCCTAAAGCCCTCGCGTCGCGACCCCAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCTCCACCCGCAAGGGCGGGACTGTCATTTACTATAGGAGGGCCCTGCACTGCGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGCATCGCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTATATCTCCCTCCTGACAAACCCCTCCTGAGCAGTGACCTCGAGACACTGCTCGGTATGGGGGACGCGGCGTCTCGACGCGTTCATAGACGACCTCACATTCGAAATATTCAACCCCCGACCCCCACGTGCTATCCGTACAACGCCGCGCGTCGTCCGAGCACAATAGATCTGGCACTGCTGAGGAACGTAACTCTGCGCTTACGCTCCATCGAGGCAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGACACCGTCGAATCCATAAATATCTTCACTGATCACGTCTCGACGGCGATCACAAGATCTTCAAAGCAAGTCGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGATCTTAGGGACCTCGTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGATATCCCACGGATTCAAACCGGACTCGGATGCGTCGCTTACAGCGGGAGGTCAAATCCCGCTTGAGCAACGCCCGAAACGAAAACTGGGATAGTTATTTAAAAGAACTCGCGCCCACTCACCAAGCATACTGGCGACTAGCTAGGACCCTCAAGTCCGAAACTATAGCCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAATCATCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACAGAGTTCGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTTAAGGAGGCGATCGATAGCCTACAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAATTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATACTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAAAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAATAAAATTCTCATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAATAGGCGTAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTGCTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTGCAGTCGGCGTCCATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTCCCGATCCACTAACGGTGCTTTTAGACGACCATAGGTCGTTGACCGCATACCTCCGCAAGGAACGCATAGGTTATCACACCTATGCGCTCCAGGAGGAGCGTGAACTCCGCGTCGTAATACGCGGAGTCCCAAAAGAGCTCGACGTCGAGCAAATTAAGAATGACCTGGTAGGTCAGTCCTACCCCGTCATAAGTGTGCACCGGATGCACAGCGGGCGCGACAAATTCGCGTATGATATGGTGCTCGTACCACTAGAACCCACACCGGAGGGCAAGAAAATTGCCTCATGTCTCCGCACCGTGTGCGGCCTATCGGGGGTCACCGTAAAGGCCCCCTACAAACGCGGCACTCCCGGGCAGTGCCACCGTTGCCAGCTCTATGGCCACTCCGCGCGTAACTGCAACGCGCGACCGCGTTGCGTGAAGTGTCTAGACGATCACGCGACCACCGATTGCTCGCGCGTAAAGGAGACAGCGACGGAGCCGCCGAGCTGTGTACTCTGCCGCAAGCAGAGACACACGGCCAACTACCGTGGATGCCCCAAGGCTCCACGGAAGCGCCCGGCAAACGCGCCCCCCAAAACCGCTGGCCCAAAGACTTCGGCGCCCCGCGCGCCGAAACCGGCTTTTTGTACCGGCTCCGGTGCCCACCGTCTCCGCGTGGGCGAAACCGTTGCCGTTCACGAAGGCAGGAACGACACCGGCACCCCAACCGCGGGCGGGACTGTCATTTACTATAGGAGGGCCCTGCACTGCGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGCATCGCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCTCCTGACAAACCCCTCCTGAGCAGTGACCTCGAGACACTGCTCGGTATGGGGGACGCGGTCATTCTGGCAGGCGACTTAAATTGCCACCACACTAGGTGGAACTGCCATCGCACGAATGTGAACGGTAGGCGTCTCGACGCGATCATAGACGACCTCACATTCGAGATATTCAACCCCCCGACCCCCACGTGCTATCCGTACAACGCCGCGCGTCGTCCGAGCACAATAGATCTGGCACTGCTGAGGAACGTAACTCTGCGCTTGCGCTTCATCGAGGCAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGTTACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGACACCGTCGAATCCATAATCATCTTCACTGAACACGTCTCGACGGCGATCATAAGATCTTCAAAGCAAGTCGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGATCTTAGGGACCTCGTAAGAGTCAGGAACGCGGCAATCCAGGCCTACGATCGATATCCCACGGATTCAAACCGGACTCGGATGCGTCGCTTACAGCGGGAGGTCAAATCCCGCCTAAGCGACGCCCGAAACGAAAACTGGGATAGTTACTTAGAACTCGCGCCCTCACACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCGTACGCCCTTCAGGCCAACCACCGGCTTTCGATGACGATGACAAGGCAGAGCTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACTGAGTCGACAGGGAGATCGAGCGCAGAGCTTCCCTGCCGCCTTAGGAAGCGTTACCCCCCATTACCACTGACGAACTCCGGCTCCGACATCGAGTCGGAAATGGAGTACGAGTCCGCCGCGAGTCCGCAACCGGGAACCTCGGACGGGTTCACCACCGTCGCGCGCGGCAAAAAACGCGCCCGCGCTGTGGAACCGTCCACGGCGCCGAAACAACCCAAGGCCGCGAACGCGTCGCGGCCTAAGACCGTAATCACGCCCGACTCCCACACTGCGTAA
Protein
MNTNSALFAQFVQLICPDIMSRFEAYKATLESNPDGSSAAAAIIIRDSPLSPPAQALRDSPMSPPTPAPASIASCAASSSGSDSESEMEFESAASPEPGTSDGFKTVTRGKKRARAVEPSAAPKQPKAANASRPKVVVSPDSPRRATPSPRPGPAPVRKVPAPPPVILREKSSWDRVSLALKAQKINVVHARNIPHGIQIKVETSDDHRSLTAYLRKERIGYHTYALQEERELRVVIRGVPKELDVEQIKNDLVGQSYPVISVHRMHSGRDKFAYDMVLVALEATPEGKKIASCLRTVCGLSGVTVEAPYKRGTPGQCHRCQLYGHSARNCNARPRCVKSLGDHATTDCSRVKETATEPPSCVLCRKQGHTANYRGCPKAPRKRPANAPPKTAGPKTSAPRAPKPAFVPAPVPTVSAWAKPLPFTKAGTTPAPQPRYAPQPLLAPRPAPAPAPRPGPAHSNDFTIIRDYIAAINIDRMRAFADAMRRAVTAEDRLNATFEYIDVIESVQHTLRDQVYEFLRDNLIDILLVQETFLKPSRRDPKVANYVMVRNDRLSTRKGGTVIYYRRALHCVPLDTPSLLHIEASVCRIALTGHQPIVIASVYLPPDKPLLSSDLETLLGMGDAASRRVHRRPHIRNIQPPTPTCYPYNAARRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESINIFTDHVSTAITRSSKQVDVEDCFHRIRLSPDLRDLVRVRNAAIRAYDRYPTDSNRTRMRRLQREVKSRLSNARNENWDSYLKELAPTHQAYWRLARTLKSETIATMPPLVRPSGQSSAYDDDDKAELLADALQEQCTTSTQHADPEHTEFVDREVERRASLPPSDALPPITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDCLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLLIAVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLDDHRSLTAYLRKERIGYHTYALQEERELRVVIRGVPKELDVEQIKNDLVGQSYPVISVHRMHSGRDKFAYDMVLVPLEPTPEGKKIASCLRTVCGLSGVTVKAPYKRGTPGQCHRCQLYGHSARNCNARPRCVKCLDDHATTDCSRVKETATEPPSCVLCRKQRHTANYRGCPKAPRKRPANAPPKTAGPKTSAPRAPKPAFCTGSGAHRLRVGETVAVHEGRNDTGTPTAGGTVIYYRRALHCVPLDTPSLLHIEASVCRIALTGHQPIVIASVYLPPDKPLLSSDLETLLGMGDAVILAGDLNCHHTRWNCHRTNVNGRRLDAIIDDLTFEIFNPPTPTCYPYNAARRPSTIDLALLRNVTLRLRFIEAMSELDSDHRPVVMQLGRPLNREPVTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESIIIFTEHVSTAIIRSSKQVDVEDCFHRIRLSPDLRDLVRVRNAAIQAYDRYPTDSNRTRMRRLQREVKSRLSDARNENWDSYLELAPSHQAYWRLARTLKSETTATMPPLVRPSGQPPAFDDDDKAELLADALQEQCTTSTQHADPEHTESTGRSSAELPCRLRKRYPPLPLTNSGSDIESEMEYESAASPQPGTSDGFTTVARGKKRARAVEPSTAPKQPKAANASRPKTVITPDSHTA

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.0234433,     Score=95

Ontologies

Topology

Length:
1948
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.05174
Exp number, first 60 AAs:
0.00461
Total prob of N-in:
0.00025
outside
1  -  1948
 
 

Population Genetic Test Statistics

Pi
2.254322
Theta
19.595581
Tajima's D
0.623415
CLR
0.110234
CSRT
0.564021798910055
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号