SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14721
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.743
 

Sequence

CDS
ATGGAAAGCAGTCGACGTCGCCCTAAACACGTCATCTCGGATCCTCCTGATCCACTAACGGTGCTTTTAGGGGACTCGTCTTTCGGCGAGTGTGCCTTAAGTCCCGGGGACGCCCGCCCCGGGCAAGACAACCAACATGAACACGAACAGCGCGCTATTCGCGCAGTTCGTGCAATATGCCCGGACATTATGTCCCGTTTTGAGGCCTACAAGGCCACGCTAGAATCGAACCCCGATGGTTCATCCGCCGCCGCCGCGATTATCATCCGCGACTCGCCGTTATCGCCTCCCGCGCCGGCACTCCGCGACTCGCCGATGTCGCCCCCCACCCCCGCGCCCGCGTCGATCGCGTCTTGCGCGGCATCGAGCTCCGGCTCCGACTCCGAGTCGGAAATGGAGTTCGAGTCGGCCGCCAGCCCTGAACCCGGAACCTCCGATGGGTTCAAAACCGTCACGCGCGGGAAAAAACGCGCCCGCGCCGTGGAACCGTCCGCGGCGCCGAAACAACCCAAGGCCGCGAACGCGTCGCGGCCTAAAGTCGTGGTCTCACCCGACTCCCCTCGCCGCGCAACCCCGTCGCCGCGCCCCGGGCCCGCGCCCGTCCGAAAAGTTCCCGCGCCGCCGCCGGTCATCCTGCGGGAAAAGTCTTCTTGGGATCGCGTGTCCCTGGCCCTTAAGGCCCAAAAGATCAATGTCGTCCATGCGAGGAATATCCCGCATGGAATTCAGATCAAGGTAGAAACATCCGACGACCATAGGTCGTTGACCGCGTACCTCCGCAAGGAACGCATAGGGTATCATACCTATGCGCTCCAGGAGGAGCGTGAACTCCGCGTCGTAATACGCGGAGTCCCCAAAGAGCTCGACGTCGAGCAAATTAAGAATGACCTGGTAGGTCAGTCCTACCCCGTCATAAGTGTGCACCGGATGCACAGCGGGCGCGACAAATTCGCGTACGATATGGTGCTCGTAGCACTAGAAGCCACACCGGAGGGCAAGAAAATTGCCTCATGTCTCCGCACCGTGTGCGGCCTATCGGGGGTCACCGTAGAGGCCCCCTACAAACGCGGCACTCCCGGGCAGTGCCACCGTTGCCAACTCTATGGCCACTCCGCGCGTAACTGCAACGCGCGACCGCGTTGCGTGAAGTGCTTAGACGATCACGCGACCACCGATTGCTCGCGCGTTAAGGAGACAGCGACGGAGCCGCCGAGCTGTGTACTCTGCCGCAAGCAGGGACACACGGCCAACTACCGTGGATGCCCCAAGGCTCCACGGAAGCGCCCGGCAAACGCGCCCCCTAAAACCGCTGGCCCAAAGACTTCGGCGCCCCGCGCGCCGAAACCGGCTTTCGTACCGGCTCCGGTGCCCACCGTCTCCGCGTGGGCGAAACCCCGTTGCCGTTCACGAAGGCAGGAACGACACCGGCACCCCAACCGCGCATTCTACAATGCTAACGGACTCGCGCGTCAGCGCGACCAGGTTTATGAGTTTCTACGTGACAATCTCATCGACATCCTTCTGGTGCAGGAGACCTTCCTAAAGCCCTCGCGTCGCGACCCCAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCTCCACCCGCAAGGGCGGGACTGTCATTTACTATAGGAGGGCCCTGCACTGCGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGCATCGCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTATATCTCCCTCCTGACAAACCCCTCCTGAGCAGTGACCTCGAGACACTGCTCGGTATGGGGGACGCGGTCATTCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGCACGAATGTGAACGGTAGGCGTCTCGACGCGTTCATAGACGACCTCACATTCGAGATATTCAACCCCCCGACCCCCACGTGCTATCCGTACAACGCCGCGCGTCGTCCGAGCACAATAGATCTGGCACTGCTGAGGAACGTAACTCTGCGCTTGCGCTCCATCGAGGCAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGACACCGTCGAATCCATAAATATCTTCACTGATCACGTCTCGACGGCGATCACAAGATCTTCAAAGCAAGTTGATGTGGAGGACTGCTTCCACCGCATCGGACTTTCCCCCGATCTTAGGGACCTCGTTAGAATCAGAAACGCGGCAATCCGGGCCTACGATCGATATCCCACGGATTCAAACCGGACTCGGATGCGTCGCTTACAGCGAGAGGTCAAATCCCGCTTGAGCGACGCCCGAAACGAAAACTGGGATAGTTATTTAGAAGAGCTCGCGCCCACTCACCAAGCATACTGGCGACTAGCTAGGACCCTCAAGTCCGAAACTATCGTCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAATCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTCGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTCAAGGAGGCGATCGATAGCCTGCAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAACTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATATTAAATGCTGCTATGACGAATTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAATAAAATTCTTATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACTCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGACCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGTATATCAACGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCCCTCCCGACTAGGCGCGTCAATAACCCCGCCCCCGCCGTTCGCCCAATCACGATGTTCGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATCAAGACGGTACGCGACCGTGCCGCCTTCCTTCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCATACACTTAAAATCATTCCAAGTCATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCACCAGTAAGTATATGCAGTCGGCGTCTACGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTCCCGATCCACTAACGGTGCTTTTAGTTTGCTTTAAGTCCCGGGGACGCCCCCCCCGGGCACACGTCACCATGAGTGACGCCAACGGCGCGCTCTTTTTAAAATTCGTCCGCGACTTCTGTCCGGACATCATCGCACGGTTCGAAGTCTACAAGGTCGGCCTTGACGCGCCGGCACTCCGCGACTCGCCGCTATCGCCCCCCGCGCCGGACCTCCGTGACTCGCCGATGTCGCCCCCCACCCCCGCACCCGCGTCGATCGCGTCTTCCGAAGCTAGCTCCGGCTCCGACTCCGAGTCGGAAATGGAGTACGAGTCCGCCGCAAGTCCCCAACCGGGAACCTCGGAAGGGTTCACCACCGTCGCGCGCGGCAAAAAACGCGCCCGCGCTGTGGACCCGCCCACGGCGCCTAAACAACCCAAGGCCGCGAACGCGTTGCGGCCTAAGACCGTCATAACCCCGGACTCCCCTCGCCGCGCCCCGGGCCCGCGCCCGTCCGAAAAGTTCCCGCGCCGCCGCCGGTCATCCTGCGGGAAAAGTCTTCTTGGGATCGCGTGTCCCTGGCCCTTAAGGCCCAAAAGATCAATGTCGTCCATGCGAGGAATAATCCCGCATGGAATTCAGATCAAGGTTGAAACATCCGACGACCATAGGTCGTTGACCGCGTACCTCCGCAAGGAACGCATAGGTTATCACACCTATGCGCTCCAGGAGGAGCGTGAACTCCGCGTCGTAATACGCGGAGTCCCAAAAGAGCTCGACGTCGAGCAAATTAAGAATGACCTGGTAGGTCAGTCCTACCCCGTCATAAGTGTGCACCGGATGCACAGCGGGCGCGACAAATTCGCGTATGATATGGTGCTCGTACCACTAGAACCCACACCGGAGGGCAAGAAAATTGCCTCATGTCTCCGCACCGTGTGCGGCCTATCGGGGGTCACCGTAGAGGCCCCCTACAAACGCGGCACTCCCGGGCAGTGCCACCGTTGCCAACTCTATGGCCACTCCGCGCGTAACTGCAACGCGCGACCGCGTTGCGTGAAGTGTCTAGACGATCACGCGACCACCGATTGCTCGCGCGTAAAGGAGACAGCGACGGAGCCGCCGAGCTGTGTACTCTGCCGCAAGCAGGGACACACGGCCAACTACCGTGGATGCCCCAAGGCTCCACGAAAGCGCCCGGCAAACGCGCCCCCCAAAACCGCTGGCCCAAAGACTTCGGCGCCCCGCGCGCCGAAACCGGCTTTTTGTACCGGCTCCGGTGCCCACCGTCTCCGCGTGGGCGAAACCGTTGCCGTTCACGAAGGCAGGAACGACACCGGCACCCCAACCGCGGGCGGGACTGTCATTTACTATAGGAGGGCCCTGCACTGCGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGCATCGCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCTGACAAACCCCTCCTGAGCAGTGACCTCGAGACACTGTTCGGTATGGGGGACGCGGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGCACGAATGTGAACGGTAGGCGTCTCGACGCGTTCATAGACGACCTCACATTCGAGATATTCAACCCTCCGACCCCCACGTGCTATCCGTACAACGCCGCGCGTCGTCCGAGCACAATAGATCTGGCACTGCTGAGGAACGTAACTCTGCGCTTGCGCTCCATCGAGGCAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGACACCGTCGAATCCATAATCATCTTCACTGAACACGTCTCGACGGCGATCATAAGATCTTCAAAGCAAGTCGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGATCTTAGGGACCTCTCTTCATCATAA
Protein
MESSRRRPKHVISDPPDPLTVLLGDSSFGECALSPGDARPGQDNQHEHEQRAIRAVRAICPDIMSRFEAYKATLESNPDGSSAAAAIIIRDSPLSPPAPALRDSPMSPPTPAPASIASCAASSSGSDSESEMEFESAASPEPGTSDGFKTVTRGKKRARAVEPSAAPKQPKAANASRPKVVVSPDSPRRATPSPRPGPAPVRKVPAPPPVILREKSSWDRVSLALKAQKINVVHARNIPHGIQIKVETSDDHRSLTAYLRKERIGYHTYALQEERELRVVIRGVPKELDVEQIKNDLVGQSYPVISVHRMHSGRDKFAYDMVLVALEATPEGKKIASCLRTVCGLSGVTVEAPYKRGTPGQCHRCQLYGHSARNCNARPRCVKCLDDHATTDCSRVKETATEPPSCVLCRKQGHTANYRGCPKAPRKRPANAPPKTAGPKTSAPRAPKPAFVPAPVPTVSAWAKPRCRSRRQERHRHPNRAFYNANGLARQRDQVYEFLRDNLIDILLVQETFLKPSRRDPKVANYVMVRNDRLSTRKGGTVIYYRRALHCVPLDTPSLLHIEASVCRIALTGHQPIVIASVYLPPDKPLLSSDLETLLGMGDAVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIFNPPTPTCYPYNAARRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESINIFTDHVSTAITRSSKQVDVEDCFHRIGLSPDLRDLVRIRNAAIRAYDRYPTDSNRTRMRRLQREVKSRLSDARNENWDSYLEELAPTHQAYWRLARTLKSETIVTMPPLVRPSGQSPAYDDDDKAELLADALQEQCTTSTQHADPEHTEFVDREVERRASLPPSDALPPITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKLIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNNPAPAVRPITMFDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFLLGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARIHLKSFQVIQSRFCRIAVGAPWFVRNVDLHDDLDLESTSKYMQSASTRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLVCFKSRGRPPRAHVTMSDANGALFLKFVRDFCPDIIARFEVYKVGLDAPALRDSPLSPPAPDLRDSPMSPPTPAPASIASSEASSGSDSESEMEYESAASPQPGTSEGFTTVARGKKRARAVDPPTAPKQPKAANALRPKTVITPDSPRRAPGPRPSEKFPRRRRSSCGKSLLGIACPWPLRPKRSMSSMRGIIPHGIQIKVETSDDHRSLTAYLRKERIGYHTYALQEERELRVVIRGVPKELDVEQIKNDLVGQSYPVISVHRMHSGRDKFAYDMVLVPLEPTPEGKKIASCLRTVCGLSGVTVEAPYKRGTPGQCHRCQLYGHSARNCNARPRCVKCLDDHATTDCSRVKETATEPPSCVLCRKQGHTANYRGCPKAPRKRPANAPPKTAGPKTSAPRAPKPAFCTGSGAHRLRVGETVAVHEGRNDTGTPTAGGTVIYYRRALHCVPLDTPSLLHIEASVCRIALTGHQPIVIASVYLPPDKPLLSSDLETLFGMGDAVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIFNPPTPTCYPYNAARRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESIIIFTEHVSTAIIRSSKQVDVEDCFHRIRLSPDLRDLSSS

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.00164467,     Score=105

Ontologies

Topology

Length:
2083
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.19248
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  2083
 
 

Population Genetic Test Statistics

Pi
194.352171
Theta
121.628984
Tajima's D
2.891225
CLR
0.200184
CSRT
0.974951252437378
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号