SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14719
Pre Gene Modal
BGIBMGA007356
Annotation
gag-like_protein_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.463
 

Sequence

CDS
ATGGCGTCATTACAAGAAAGTCAAATGGCAGCATTCGAACGCCTACTCGACCGAGTTTTTGAGCATAAAACTCAACTCGAATCATCAGCAACACCGACGTCGGAGCCGACATCGCCGCCTTCCTCGACGCCCGCTCACCATTCTGGGAACTTCGCGTCATGCACGGCGCGGTTCAGCGGAGCGCCCGGCGACTCACTCGACGGTTTCCTTGACGCGGTCGAATCATACAAAGATTGTGCTGACGTAGGACACGTCATCGCGTTACGAGGACTCCCGATGTTACTAACCGGAAATGCAGCCGTGTGGTGGCAAGGCGTTAAAGCTAGCATCACTTCCTGGGACGACGCTTTATCATCGTTACGAAGCGCTTTCGGTGATTGCAGACCGCCCCATCGAGTCTACTTAGAGCTCTTCAAAATGTCGCAAGGACAAAGAGAGAAGACGGAGATCTTCGTTGCCAGAGCACGAGCCCTACTAGCTCGACTCCCACCTGGTGACCTTAGTGAGAAAGTTCAAATTGATATGCTTTACGGCCTTCTACACCGTCGTGTTCGTAAAAGATTAAGAAGAGACGAAGTAACTTCATACGACACGTTATTAAAGAAAACGCGCCATATCGAGGACTCCATCTACGAGACCAGTCCGCCTGAATTTATTCATCATCCTCAGCGAGCGACGCCACATGCTCAAAATAATGAAACTTTGCTTGGCATGGATTTTTTGGTGGCAGCAGGTATTGTGCTTGACTTTGCTTCATCCACTTGGCATTTTTCAGGAAAACGGGTTACCTATCCAATTGAATATGAGTGCCCTAAGCCATGCATGTTTGCTTCTACTGCTGACTTCCTGCGTGATGATAAGGGTTCTATGCTTGGCTCCGATGAACGGCAGCAGCTATCACATTTATTGCAGGAGAATGGAGACATCTTTAGGCTATACAATGCCAAAAAATCTAGTGATGTAGATGATGGAAGGTTCCAGCTGTTCGTTAGCAACTATAAAGATTCAGACATCAATGAAAATTATAGAAAAAAAATTCAAAAATTTGAGGCAAGCTCAATACCACCGCATAAGAGTGAGCTTTATCAACAACTTTTGAGGGCCCACTATATTTCTTCTATTTGGAGAAATGCTTACAAAAAGCAACTCACAACTTTAGACCCATTGGAGTATGGTTGGATTGAGCAGGACAACATATATGCCTTCAAAGGGTTCGAAGGTGACCAACTTCCATATTTTGTGAGTGACTTAATCACCAATGTTCCTGTTCGTCCGGACATCATATCGAGATTTGAAGCCTACAAGGCCGGCCTTGACGCGCCGGCACTCCGTGACTCTCCGTTGTCGCCCCCCGCGCCGGTACCGCGCGACTCGCCGATGTCGCCCCCCACCCCCGCGCCCGCGTCGATCGCGTCCTCCGTAGCGGTAAGCTCCGGCTCCGACTCCGAGTCGGAAATGGAGTACGAGTCCGCCGCGAGTCCCCAACCGGGAACCTCGGAAGGGTTCACCACCGTCGCGCGCGGCAAAAAACGCGCCCGCGCTGTGGATCCGCCCACGGCGCCCAAACCACCCAAGGCCGCGAACGCCTCGCGGCCGAAGACCGTCATAACCCCGGACTCCCCTCGCCGCGCAACCCCGTCGCCGCGCCCCGGGCCCGCGCCCGTCCGAAAAGTTCCCGCGCCGCCGCCGGTCATCCTGCGGGAAAAGTCTTCTTGGGATCGCGTGTCCCTGGCCCTTAAGGCCCAAAAGATCAATGTCGTCCATGCGAGGAATATCCCGCATGGAATTCAGATCAAGGTTAAAACATCCGACGACCATAGGTCGTTGACCGCGTACCTCCGCAAGGAACGCATAGGGTATCATACCTATGCGCTCCAGGAGGAGCGTGAACTCCGCGTCGTAATACGCGGAGTCCCCAAAGAGCTCGACGTCGAGCAAATTAAGAATGACCTGGTAGGTCAGTCCTACTCCGTCATAAGTGTGCACCGGATGCACAGCGGGCGCGACAAATTCGCGTACGATATGGTGCTCGTAGCACTAGAAGCCACACCGGAGGGCAAGAAAATTGCCTCATGTCTCCGCACCGTGTGCGGCCTATCGGGGGTCACCGTAGAGGCCCCCTACAAACGCGGCACTCCCGGGCAGTGCCACCGTTGCCAACTCTATGGCCACTCCGCGCGTAACTGCAACGCGCGACCGCGTTGCGTGAAGTGCTTAGACGATGACGCGACCACCGATTGCTCGCGCGTAAAGGAGACAGCGACGGAGCCGCCGAGCTGTGTACTCTGCCGCAAGCAGGGACACACGGCCAACTACCGTGGATGCCCCAAGGCTCCACGGAAGCGCCCGGCAAACGCGCCCCCTAAAACCGCTGGCCCAAAGACTTCGGCGCCCCGCGCGCCGAAACCGGCTTTCGTACCGGCTCCGGTGCCCACCGTCTCCGCGTGGGCGAAACCGTTGCCGTTCACGAAGGCAGGAACGACACCGGCACCCCAACCGCGGTACGCGCCGCAACCTCTACTCGCGCCGCGCCCCGCCCCCGCGCCCGCGCCCGGTCCCGCGCCTCGCCCCGGCCCCGCGCACTCAAACGATTTTACGATTATTCGCGACTACATCGCCGCGATAAACATTGACCGCATGCGTGCATTCGCCGACGCCATGCGCAGAGCGGTCACAGCCGAAGACCGCCTAAACGCGACGTTCGAATACATCGACGTCATCGAGTCCGTCCAGCGCACGCTGCGCGACCAGGTTTATGAGTTTCTACGTGACAACCTCATCGACATCCTTCTGGTGCAGGAGACCTTCCTAAAGCCCTCGCGTCGCGACCCCAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCTCCACCCGCAAGGGCGGGACTGTCATTTACTATAGGAGGGCCCTGCACTGCGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGCATCGCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCTCCTGACAAACCCCTCCTGAGCAGTGACCTCGAGACACTGCTCGGTATGGGGGACGCGGTCATTCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGCACGAATGTGAACGGTAGGCGTCTCGACGCGTTCATAGACGACCTCACATTCGAGATATTCAACCCTCCGACCCCCACGTGCTATCCGTACAACGCCGCGCGTCGTCCGAGCACAATAGATCTGGCACTGCTGAGGAACGTAACTCTGCGCTTGCGCTCCATCGAGGCAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCAGTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGA
Protein
MASLQESQMAAFERLLDRVFEHKTQLESSATPTSEPTSPPSSTPAHHSGNFASCTARFSGAPGDSLDGFLDAVESYKDCADVGHVIALRGLPMLLTGNAAVWWQGVKASITSWDDALSSLRSAFGDCRPPHRVYLELFKMSQGQREKTEIFVARARALLARLPPGDLSEKVQIDMLYGLLHRRVRKRLRRDEVTSYDTLLKKTRHIEDSIYETSPPEFIHHPQRATPHAQNNETLLGMDFLVAAGIVLDFASSTWHFSGKRVTYPIEYECPKPCMFASTADFLRDDKGSMLGSDERQQLSHLLQENGDIFRLYNAKKSSDVDDGRFQLFVSNYKDSDINENYRKKIQKFEASSIPPHKSELYQQLLRAHYISSIWRNAYKKQLTTLDPLEYGWIEQDNIYAFKGFEGDQLPYFVSDLITNVPVRPDIISRFEAYKAGLDAPALRDSPLSPPAPVPRDSPMSPPTPAPASIASSVAVSSGSDSESEMEYESAASPQPGTSEGFTTVARGKKRARAVDPPTAPKPPKAANASRPKTVITPDSPRRATPSPRPGPAPVRKVPAPPPVILREKSSWDRVSLALKAQKINVVHARNIPHGIQIKVKTSDDHRSLTAYLRKERIGYHTYALQEERELRVVIRGVPKELDVEQIKNDLVGQSYSVISVHRMHSGRDKFAYDMVLVALEATPEGKKIASCLRTVCGLSGVTVEAPYKRGTPGQCHRCQLYGHSARNCNARPRCVKCLDDDATTDCSRVKETATEPPSCVLCRKQGHTANYRGCPKAPRKRPANAPPKTAGPKTSAPRAPKPAFVPAPVPTVSAWAKPLPFTKAGTTPAPQPRYAPQPLLAPRPAPAPAPGPAPRPGPAHSNDFTIIRDYIAAINIDRMRAFADAMRRAVTAEDRLNATFEYIDVIESVQRTLRDQVYEFLRDNLIDILLVQETFLKPSRRDPKVANYVMVRNDRLSTRKGGTVIYYRRALHCVPLDTPSLLHIEASVCRIALTGHQPIVIASVYLPPDKPLLSSDLETLLGMGDAVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIFNPPTPTCYPYNAARRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPVNREPDTRTMVD

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
1131
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.17422
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00818
outside
1  -  1131
 
 

Population Genetic Test Statistics

Pi
294.109056
Theta
186.074165
Tajima's D
2.320548
CLR
0.439345
CSRT
0.928153592320384
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号