SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14717
Pre Gene Modal
BGIBMGA007296
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
PiggyBac transposable element-derived protein 3       + More
Chimeric ERCC6-PGBD3 protein      
PiggyBac transposable element-derived protein 1      
PiggyBac transposable element-derived protein 4      
Alternative Name
Chimeric CSB-PGBD3 protein
Cerebral protein 4
Location in the cell
Nuclear   Reliability : 3.566
 

Sequence

CDS
ATGTCTAAACGGTTGGCAGAGCAAGATATTGAAAATATTTTATCAGTTCTCGAAAATGGAGACATTTCTGAAGATGAAGAGTCTATAGGAGACGAAAATGACATAGATTACTACTCGACTGTACAAGATCTGATACAGGATTTAGAAGATGCAGAAGAAGATCAGTACAATGCAAATCCTGATGTACCTATTGAAGAAGACCATCTACCGGATGAGTTTTCAGTTCCAGGGCCTTCACTTAGTCGCCCACTATCAGGTGTCATTGGTGCAGCAGCCTTGAGGCAACGAAGTAGGCAACTTATATGGAAAAAAGGCAATTTGGAATTTAGTGAAGACCGCATAAGTTTTACAGGTAATACAGACCTTTCCCCAGAATTTGCCCAACTAGAAACACCATTTCAGTATTTTACGCTATTTTTAAACGATGATATATTAGTAAAAATCGTGAATGAGACCAATTTGTATATCACGCAAAAAGGCATCTCCAACTGCCCTCCTGTAAATGTCAAGGAAATTCGTCAGTTTCTTGGTATTATTATATTTATGTCAGTATATCACTTCCCAAATGTAAGATCATATTGGGGTAAGTATGGCTTCAAACATATAATGGAAACGATGACGCTAAATAGATTTGGAAAACTACGATCCGTCATTCACTTCAATGACAACTCATTACACAAGCCCGTTGGTCACCCAAACCACGACCGTCTGCATAAAATAAGACCTGTAGAGGCACATTTGAATAAATTATTTTTGAGTGTGGCACCATTTGAGCAGAGACTGTCCTTAGATGAACAGATGTGCTCTACGAAAGTAGCGCATTTCATGAAACAATACCTCCCCAACAAGCCCCATAAGTGGGGTTTCAAGCTATACGTTCTGTGCTCATTGTCTGGTTACGCTCACAATTTTGAAATTTATTCTGGAAAACAGGATATTCAATACTCAAGTGATGAACCTGATCTTGGTGTAGTAGGCAACACAGTCATCAGATTGTGCCGTTCAGTTCCACGAAGAATGAACCACATAATTTATTTTGATAATTTTTATTCGTCAATTCCTTTGTTATATTACCTACATACTCAAGGTATATATGCATTGGGCACAATTCAGAGGAACCGACTCGGTAAAACCTGTAAGTTGCCGGTAGTAAAAGAGTTTATGAAGGACTCTGTTCCAAGGGGATCATATGAGGAACTCGTAGCAGACTATGAAGGTGTGGATATCTCGGTAACTTGTTGGAAGGATAATAAGCTTGTTACGTTGGTATCTACTTATGTTGGTTCCGAACCGGCTGAAACTGTCAGCAGATTTGATAAGAAACAAAAGAAAAAGGTCTCTGTTGCCTGTCCAAAAATTGTAAAAGATTACAATGCCCACATGGGTGGAGTAGATTTGATGGACAGTTATTTGGGCCGCTACAAAATTCGAATCGAAAGTCGAAAATGGGGACTCGCCTTTCGGCGAGTTTGCTTTAAGTCCCGGGGACGCCCCCCCCGGGCACACGTCACCATGAGTGACGCCAACGATGCGCTCTTCATTAAGTTCGTCCGCGACTTCTGTCCGGACATAGTCGCACGCTTCGAAGTTTACAAGGCCGGCCTTGACGCGCCGGCACTCCGAGACTCTCCGTTGTCGCCCCCCGCGCCGGTACCTCGCGACTCGCCACTGTCGCCCCCCACCCCCGCGCCCGTGTCAATCGCGTCCTCCGTAGCAGTAAGCTCCGGCTCCGACTCCGAGTCGGAAATGGAGTACGAGTCCACCGCGAGTCCTCAACCGGGAACCTCGGAAGGGTTCACCACCGTCGCGCGCGGCAAAAAACGCGCCCGCGCTGTGGATCCACCCACGGCGCCCAAACAACCCAAGGCCGCGAACGCCTCGCGGCCTAAGACCGTTATAACCCCGGAATCCCCTCGCCGCGCAACCCCGTCGCCGCGCCCCGGGCCCGCGCCCGTCCGAAAAGTTCCCGCGCCGCCGCCGGTCATCCTGCGGGAAAAGTCTTCGTGGGATCGCGTATCCCTGGCCCTTAAGGCCCAAAAGATAAATGTAGTCCATGCACGAAATATCCCGGATGGAATACAAATCAAGGTCGAAACATCAGACGACCATAGGTCATTGACCGCATACCTCCGCAAGGAACGCATAGGTTATCATACCTATGCGCTCCAGGAGGAGCGTGAACTCCGCGTCGTAATACGCGGAGTCCCAAAAGAGCTCGACGTCGAGCAAATTAAGAATGACCTGGTAGGTCAGTCCTACCCCGTCATAAGTGTGCACCGGATGCACAGCGGGCGCGACAAATTCGCGTATGATATGGTGCTCGTAGCACTAGAAGCCACACCGGAGGGCAAGAAAATTGCCTCATGTCTCCGCACCGTGTGCGGCCTATCGGGGGTCACCGTAGAGGCCCCCTACAAACGCGGCACTCCCGGGCAGTGCCACCGTTGCCAGCTCTATGGCCACTCCGCGCGTAACTGCAAAGCGCGACCGCGTTGCGTGAAGTGTTTAGACGATCACGCGACCACCGATTGCTCGCGCGTAAAGGAGACAGCGACGGAGCCGCCGAGCTGTGTACTCTGCCGCAAGCAGGGACACACGGCCAACTACCGTGGATGCCCCAAGGCTCCACGGAAGCGCCCGGCAAACGCGCCCCCTAAAACCGCTGGCCCAAAGACTTCGGCGCCCCGCGCGCCGAAACCGGCTTTCGTACCGGCTCCGGTGCCCACCGTCTCCGCGTGGGCAAAACCGTTGCCGTTCACGAAGGCAGGAACGACACCGGCGCCCCAACCGCGATACGCGCCGCAACCTCTACTCGCGCCGCGCCCCGCCCCCGCCCCCGCCCCCGCGCCTCGCCCCGCCCCCGCGCACTCAAACGACTTCTCGATCATACGAGATTACATCGCCGCTATAAACATAGACCGCATGCAAAACGAGAACCCCGCGTTGTTCGCGAAATTCGTCCGTGAGTACTGCCCGGACATTATGTCAAAGTTTAGGGCGTACAAAGCCAGTCTAGCATCGAACCCCGACGATTCGTCCGCCGCCGCCGCGATAATCCGAGACTCTCCGCTGTCGCCTCCCGCGCCGGTACTCCGCGACTCGCCGATGTCGCCCCCCACCCCCGCGCCCGCGTCGATCGCGTCATTCGCGGCATCGAGCTCCGGCTCCAACTCCGAGTCGGAGATGGAGTTCGAGTCGGCCGCCAGCCCCGAACCCGGAACCTCCGATGGGTTCAAAACCGTCACGCGCGGTAAGAAACGCGCCCGCGCCGTGGAACCGTCCGCGGCGCCGAAACAACCCAAGGCCGCGAACGCGTCGCGGCCTAAAGTCGTGGCACTCAACGTCAACGTCGTCCATGCGCGTAACATCGCGCACGGCATACAAATTAAGACGGCCTCACCGGACGATAACAGGGCGCTGACAGCCCACCTCCGTAAGGAGCGCATAAGCTTCCACACTTATGCGCTCCAGGAGGATCGCGAGCTCCGCGTAGTAATACATGGAGTACCGAAGGAGCTCGACGTCGAGCTAGTCAAGGAGGACGTCGAGCTAGTCAAGGAGGACCTCATCGGGCAGGCGTACCCGATTATAAGCGTGCACCGAATGCACAGCGGCCGAAATAGGTTCCCATTCAATATGGTTCTCGTCGCGCTAGAACAAACTCCAGAAGGCAAACGGATTGCCTCAAGTCTCCGCACCGTTTGCGCATTCTACAATGCTAACGGACTCGCGCGTCAGCGCGACCAGGTTTATGAGTTTCTCCGCGAAAATCTCATCGACATCCTTCTGTTGCAGGAGACCTTCCTAAAGCCCTCGCGTCGCGACCCCAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCTCCGCCCCCAAGGGCAGGACTGTCATTTACTATAGGAGGGCCCTGCACTGCGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGCATCGCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTCTATCTCTCCCCTGACAAACCCCTCCTGAGCAGTGACCTCGAGACACTGCTCGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTCGCGGCCCGGATTCAACTCCATCCCCCGAGGACACAGTCGAATCCATAAACATCTTCACTGATCACGTCTCGACGGCGATCATAAGATCTTCAAAGCAAGTCGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGATCTTAGAGACCTCAGGACTCACCTTTCGGCGAATTACATAAGTCCCGGGGACGCCCCCCCCGGGCACCCCTTCAAAATGACGGACGAGGACAGCGCGCTGTTCTCACTATTCGTCCGCGAATTCTGCCCGGACATGTCCCGTTTCGAGGCCTACAAGGCCAACCTAGATAGCTTTTCTAAAGGAGATTGTTTGGTGACGCACTCGCCGCCGATTATGCGTGGCGATGTGACCTTCGCGACAGGGGGGAACCACGTCCCGGAGAAGGAGCGATTAGAGCGCGGAGGCTCCAATCTCGGCGATATTCGGAGTCATTTGGAAGGCAAAGCCAAGTTGGCGTCCAAAATGCTGGGAGTCCTCAACAGAGCGAAGCGGTACTTCACGCCTGGACAAAGGCTTTTGCTTTATAAAGCACAAGTCCGGCCTCGCGTGGAGTACTGCTCCCATCTCTGGGCCGGGGCTCCCAAATACCAGCTTCTTCCATTTGACTCCATACAGAGGAGGGCCGTTCGGATTGTCGATAATCCCGGTCTCACGGATCGTTTGGAACCTCTGGGTCTGCGGAGGGACTTCGGTTCCCTCTGTATTTTGTACCGTATGTTCCATGGGGAGTGCTCTGAGGAATTGTTCGAGATGATACCGGCATCTCGTTTTTACCATCGCACCGCCCGCCACCGGAGTAGAGTTCATCCATACTACCTGGAGCCACTGCGGTCATCCACAGTGCGTTTCCAGAGGTCTTTTTTGCCACGTACCATCCGGCTATGGAATGAGCTCCCCTCCACGGTGTTTCCCGAGCGCTATGACATGTCCTTCTTCAAACGAGGCTTGTGGAGAGTATTAAGCGGTAGGCAGCGGCTTGGCTCTGCCCCTGGCATTGCTGAAGTCCATGGGCGACGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTACAGTCGGCGTCGATGCGCCACTTCGATAAAGTGGCACGACACGAGAACCCTCTCATCGTGGCCGCCAGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTCCCGATCCACTAACAGTGCTTTTAGGTATCAGATACTCAAGGGGACTCGCCTTTCGGCGAGTTTGCTTTAAGTCCCGGGGACGCCCCCCCCGGGCACACGTCACCATGGGTGACACCAACACCAACGCTGCGCTCTTCTTTAAGTTCGTCCGCGACGTCTGTCCGGACATAATCGCAAAGTTCGAAGCTTACAAGGCCGGCCTTGACGCGCCGGCACTCCGCGACTCTCCGTTGTCGCCCCCCGCGCCGGTACCTCGCGACTCGCCGATGTCGCCCCCCACCCCCGCGCCTGCGTCGATCGCGTCTTGCGCGTCATCAAGCTCCGGCTCCGACTCCGAGTCGGAAATGGAGTACGAGTCCGCCGCGAGTCCCCAACCGGGAACCTCGGAAGGGTTCACCACCGTCGCGCGCGGGAAAAAACGCGCCCGCGCCGTGGAACCGTCCGCGGCGCCGAAACAGCCAAAGGCCGCGAACGCGTCGCGTCCTAAAGTCGTGGTCTCACCCGACTCCCCTCGCCGCGCAACCCCGTCGCCGCGACCCCAACCCGCGTCCGTCCGCAAAATTCCCGCGCCGCCGCCGGTAATTTTGCAAGATAAAACCGCGTGGGATCGCGTATCCCGTGCCTGTAAGGCACAAAACGTCACCGTCATCCATGCGCGTAACATCGCGCACGGTATACAAATAAAAACGGCCTCACCGGACGACCACAGGGCGCTGACAGCCCACCTCCGAAAGGAACGCATAAGCTTCCACACTTATGCGCTCCAGGAGGATCGCGAGCTCCGCGTAGTAATACGCGGAGTACCGAAGGAGCTCGACGTCGAGCTGGTCAAGGAGGACCTCATCAGGCAGGCGTACCCGATTGTAAGCGTGCACCGAATGCACAGCGGGCGCGATAAATTCGCATATAATATGGTTCTCGTCGCGTTAGAACCAACCGCCGAAGGCAAACGGATTGCCTCAAGCCTCCGCACCGTTTGCGGCTTATCCGGGGTCACCGTCGAGGCCCCATATAAAAAAGGCACTCCCGGGCAGTGCCACCGCTGTCAGTTATACGGCCACTCCGCGCGCAACTGCCACGCGCGCCCGCGGTGCGTAAAGTGCCTCGGCGACCACGCGACAGCCGACTGTTCGCGGGTCAAAGAGACAGCGACTGAACCACCGAGCTGTGTGCTCTGCCAGAAGCAGGGCCACACAGCCAACTACCGCGGATGCCCCAAGGCCCCGCGGAAGCGTCTGGCCAACGCGCCTCCAAAAACCGTCGGCCCTAAGACTTCGGCGCCCCGCGCGCCGAAACCTGCCTTCGTGCCGGCACCGCGCGATCAAGTATATGAGTTTCTCCGCGACAATCTCATCGACATCCTTCTGGTGCAGGAGACCTTCCTAAAGCCCTCGCGTCGCGACCCCAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCTCCGCCCGCAAGGGCGGGACTGTCATTTACTATAGGAGGGCCCTGCACTGCGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGCATCGCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCTGACAAACCCCTCCTGAGCAGTGACCTCGAGACACTGTTCGGTATGGGGGACGCGGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGCACGAATGTGAACGGTAGGCGTCTCGACGCGTTCATAGACGACCTCACATTCGAAGTATTCAACCCCCCGACCCCCACGTGCTATCCGTACAACGCCGCGCGTCGTCCGAGCACAATAGATCTGGCACTGCTGAGGAACGTAACTCTGCGCTTACGCTCCATCGAGGCAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGATACCGTCGAATCCATAAACATCTTCACTGATCACGTCTCGACGGCGATCATAAGATCCTCGAAACAAGTCAATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGAACTTAGGGACCTAGTTAGAATTAGAAACGCGGCAATCCGGGCCTACGATCGATATCCCACGGATTCAAACCGGACTCGGATGCGTCGCTTACAGCGGGAGGTCAAATCCCGCTTAAGCGACGCCCGAAACGAAAACTGGGATAGTTATTTAGAAGAACTCGCGCCCACTCACCAAGCATACTGGCAACTAGCTAGGACCCTCAAGTCCGAAACTATAGCCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAACCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTCGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCTCCATTACCACTTCCGAGGTCAAGGAGGCGATCGATAGCCTACAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAACTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATATTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAATAAAATTCTTATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGTATATCAACGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATTAACCCTACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCTCTCCCGACTAGGCGCGTCAATAACCCCGCCCCCGCCGTTCGCCCAATCACGATGTTCGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATCAAGACGGTACGCGACCGTGCCGCCTTCATTCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCATACACTTAAAATCCTTTCAAATTATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTTCAGTCGGCGTCCATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCTAAACACGTCATCTCGGATCCTCCTGATCCACTAACGGAGGACCGCGAGCTCCGCGTAGTAATACGCGGAGTTCCGAAAGAACTCGACATAGAGTACGTAAGGGAGGATCTGACCGCTCAGTCCCTCCCGATAGTTAGTGTGCACCGGATGCACAACGGACGCGATAAAAAACCATATAACATGGTTCTAGTCGCTCTAGAACCAACCCCGGAGGCCAAGAAAAAGATCGCATGTCTCGCGACAGTATGTGGCCTATCCGGGGTTACCATTGAAGCCCCCCATAGACGTGGCACTCCCGGACAGTGCCACAGATGCCAACTATATGGCCACTCGGCTCGGAATTGCCACGCGCGCCCCCGCTGCGTGAAGTGTCTCGGCGATCACGCCACGGTAGATTGCTCGCGAGTTAAGGAAACCGCGACCGAACCTCCAAGCTGTGTCCTATGCCTTAAGCAAGGGCACCCCGCGAATTACCGTGGATGTCCTAGGGCTCCGCGAAAACGTCCGACCCACCCAGCCCCCCGTACCGTCGGCCCAAAGACTTCGGTGCCTTCAGCACCGAAACCCGCCTTCGTACCGGCTGCGGTTCCCACCGTCTCGGCGTGGAATAAACCGCTGCCGTATACGAGGTCGGGAACACAAACCGCACCCCAGCCCCCGCTCGCGACACGTCCCGCGCCGCAGCCCCTGCTCGCACCTCCCCCCGCGCCCGCGTACCGTCCCCCGCAACCCTCAGCCGTCAACGACTTCACGCTCGTGCGCGACTTTGTCACGGCGGTCAACTTCGACCGTCTGCGATCGTTCGCAGACGCGTTGAGTCGGAAATGGAATAAGACTTCGCCGCGAGTCCGCAACTCGAAACCTCGGACGGGTTCACTACCGTCGCGCGCGGAGGAACGCGAACTCCGCGTAGTAATACGCGGAGTACCCAAGGAGCTCGATGCCGAGCTAGTCAAGGACGACCTCATCAGGCAAGCATACCCGATAATAAGTGTGCATCGGGTGCACAGCGGTCGCGACAAGTTTCCATACAATATGGTGTATACCATTCCATTCCATACACCGCGGAAAGCCAACGGATTGCCTCAAGTCTCCGCACCGTTTGCGGCCTATCTGGGGTAA
Protein
MSKRLAEQDIENILSVLENGDISEDEESIGDENDIDYYSTVQDLIQDLEDAEEDQYNANPDVPIEEDHLPDEFSVPGPSLSRPLSGVIGAAALRQRSRQLIWKKGNLEFSEDRISFTGNTDLSPEFAQLETPFQYFTLFLNDDILVKIVNETNLYITQKGISNCPPVNVKEIRQFLGIIIFMSVYHFPNVRSYWGKYGFKHIMETMTLNRFGKLRSVIHFNDNSLHKPVGHPNHDRLHKIRPVEAHLNKLFLSVAPFEQRLSLDEQMCSTKVAHFMKQYLPNKPHKWGFKLYVLCSLSGYAHNFEIYSGKQDIQYSSDEPDLGVVGNTVIRLCRSVPRRMNHIIYFDNFYSSIPLLYYLHTQGIYALGTIQRNRLGKTCKLPVVKEFMKDSVPRGSYEELVADYEGVDISVTCWKDNKLVTLVSTYVGSEPAETVSRFDKKQKKKVSVACPKIVKDYNAHMGGVDLMDSYLGRYKIRIESRKWGLAFRRVCFKSRGRPPRAHVTMSDANDALFIKFVRDFCPDIVARFEVYKAGLDAPALRDSPLSPPAPVPRDSPLSPPTPAPVSIASSVAVSSGSDSESEMEYESTASPQPGTSEGFTTVARGKKRARAVDPPTAPKQPKAANASRPKTVITPESPRRATPSPRPGPAPVRKVPAPPPVILREKSSWDRVSLALKAQKINVVHARNIPDGIQIKVETSDDHRSLTAYLRKERIGYHTYALQEERELRVVIRGVPKELDVEQIKNDLVGQSYPVISVHRMHSGRDKFAYDMVLVALEATPEGKKIASCLRTVCGLSGVTVEAPYKRGTPGQCHRCQLYGHSARNCKARPRCVKCLDDHATTDCSRVKETATEPPSCVLCRKQGHTANYRGCPKAPRKRPANAPPKTAGPKTSAPRAPKPAFVPAPVPTVSAWAKPLPFTKAGTTPAPQPRYAPQPLLAPRPAPAPAPAPRPAPAHSNDFSIIRDYIAAINIDRMQNENPALFAKFVREYCPDIMSKFRAYKASLASNPDDSSAAAAIIRDSPLSPPAPVLRDSPMSPPTPAPASIASFAASSSGSNSESEMEFESAASPEPGTSDGFKTVTRGKKRARAVEPSAAPKQPKAANASRPKVVALNVNVVHARNIAHGIQIKTASPDDNRALTAHLRKERISFHTYALQEDRELRVVIHGVPKELDVELVKEDVELVKEDLIGQAYPIISVHRMHSGRNRFPFNMVLVALEQTPEGKRIASSLRTVCAFYNANGLARQRDQVYEFLRENLIDILLLQETFLKPSRRDPKVANYVMVRNDRLSAPKGRTVIYYRRALHCVPLDTPSLLHIEASVCRIALTGHQPIVIASVYLSPDKPLLSSDLETLLDHRPVVMQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPRGPDSTPSPEDTVESINIFTDHVSTAIIRSSKQVDVEDCFHRIRLSPDLRDLRTHLSANYISPGDAPPGHPFKMTDEDSALFSLFVREFCPDMSRFEAYKANLDSFSKGDCLVTHSPPIMRGDVTFATGGNHVPEKERLERGGSNLGDIRSHLEGKAKLASKMLGVLNRAKRYFTPGQRLLLYKAQVRPRVEYCSHLWAGAPKYQLLPFDSIQRRAVRIVDNPGLTDRLEPLGLRRDFGSLCILYRMFHGECSEELFEMIPASRFYHRTARHRSRVHPYYLEPLRSSTVRFQRSFLPRTIRLWNELPSTVFPERYDMSFFKRGLWRVLSGRQRLGSAPGIAEVHGRRIAVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKVARHENPLIVAASNYIPDPADRMESSRRRPKHVISDPPDPLTVLLGIRYSRGLAFRRVCFKSRGRPPRAHVTMGDTNTNAALFFKFVRDVCPDIIAKFEAYKAGLDAPALRDSPLSPPAPVPRDSPMSPPTPAPASIASCASSSSGSDSESEMEYESAASPQPGTSEGFTTVARGKKRARAVEPSAAPKQPKAANASRPKVVVSPDSPRRATPSPRPQPASVRKIPAPPPVILQDKTAWDRVSRACKAQNVTVIHARNIAHGIQIKTASPDDHRALTAHLRKERISFHTYALQEDRELRVVIRGVPKELDVELVKEDLIRQAYPIVSVHRMHSGRDKFAYNMVLVALEPTAEGKRIASSLRTVCGLSGVTVEAPYKKGTPGQCHRCQLYGHSARNCHARPRCVKCLGDHATADCSRVKETATEPPSCVLCQKQGHTANYRGCPKAPRKRLANAPPKTVGPKTSAPRAPKPAFVPAPRDQVYEFLRDNLIDILLVQETFLKPSRRDPKVANYVMVRNDRLSARKGGTVIYYRRALHCVPLDTPSLLHIEASVCRIALTGHQPIVIASVYLPPDKPLLSSDLETLFGMGDAVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEVFNPPTPTCYPYNAARRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESINIFTDHVSTAIIRSSKQVNVEDCFHRIRLSPELRDLVRIRNAAIRAYDRYPTDSNRTRMRRLQREVKSRLSDARNENWDSYLEELAPTHQAYWQLARTLKSETIATMPPLVRPSGQPPAYDDDDKAELLADALQEQCTTSTQHADPEHTEFVDREVERRASLPPSDALPSITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNNPAPAVRPITMFDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARIHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTEDRELRVVIRGVPKELDIEYVREDLTAQSLPIVSVHRMHNGRDKKPYNMVLVALEPTPEAKKKIACLATVCGLSGVTIEAPHRRGTPGQCHRCQLYGHSARNCHARPRCVKCLGDHATVDCSRVKETATEPPSCVLCLKQGHPANYRGCPRAPRKRPTHPAPRTVGPKTSVPSAPKPAFVPAAVPTVSAWNKPLPYTRSGTQTAPQPPLATRPAPQPLLAPPPAPAYRPPQPSAVNDFTLVRDFVTAVNFDRLRSFADALSRKWNKTSPRVRNSKPRTGSLPSRAEERELRVVIRGVPKELDAELVKDDLIRQAYPIISVHRVHSGRDKFPYNMVYTIPFHTPRKANGLPQVSAPFAAYLG

Summary

Description
Binds in vitro to PGBD3-related transposable elements, called MER85s; these non-autonomous 140 bp elements are characterized by the presence of PGBD3 terminal inverted repeats and the absence of internal transposase ORF.
Involved in repair of DNA damage following UV irradiation, acting either in the absence of ERCC6 or synergistically with ERCC6. Involved in the regulation of gene expression. In the absence of ERCC6, induces the expression of genes characteristic of interferon-like antiviral responses. This response is almost completely suppressed in the presence of ERCC6. In the presence of ERCC6, regulates the expression of genes involved in metabolism regulation, including IGFBP5 and IGFBP7. In vitro binds to PGBD3-related transposable elements, called MER85s; these non-autonomous 140 bp elements are characterized by the presence of PGBD3 terminal inverted repeats and the absence of internal transposase ORF.
Miscellaneous
PGBD3 gene is located within ERCC6 intron 5.
Keywords
Alternative splicing   Complete proteome   DNA-binding   Nucleus   Phosphoprotein   Polymorphism   Reference proteome   Disease mutation   Isopeptide bond   Premature ovarian failure   Ubl conjugation  
Feature
chain  PiggyBac transposable element-derived protein 3
sequence variant  In dbSNP:rs4253072.
Pfam
PF13843   DDE_Tnp_1_7        + More
PF02023   SCAN
PF13842   Tnp_zf-ribbon_2
Interpro
IPR029526   PGBD        + More
IPR003309   SCAN_dom       
IPR038269   SCAN_sf       
IPR001190   SRCR       
IPR032718   PGBD4_C_Znf-ribbon       
Gene 3D
PDB
6AR3     E-value=0.00276399,     Score=105

Ontologies

Topology

Subcellular location
Nucleus  
Length:
3527
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.75441000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.04420
outside
1  -  3527
 
 

Population Genetic Test Statistics

Pi
271.857534
Theta
192.760503
Tajima's D
3.07461
CLR
0.208664
CSRT
0.982400879956002
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号