SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14713
Annotation
PREDICTED:_nascent_polypeptide-associated_complex_subunit_alpha?_muscle-specific_form-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.077
 

Sequence

CDS
ATGTCGGGGGGGAACCCACCTCCAACTATCAGCACACCCGGCCCGTCTCATAAGGGACGACAGGCAATGCCGGAAGTTCAATTACCAACACCAACACCTGCAATCCGTATGGCCCCGATGGGACCCGGTGCGGGCAGTTCGGCCGGGCCTTCGGCCGCGGCCAGGGGACCCCTGAGGATCGTACCGGTGGAAAGTAACTTTCCTACGTCGGCCGATCCCTCTGGGCCCTCTCGGCCGCGGAAGAAGGCCAGGTCAGAGTCTGACCGAGGCTCATCGGGCGACCAAGATAAACGCCCACGTATAGGCCCTTCCTCCAGGTCGGAGGGAGAAGAGAGCGTGACCACGTCCACGGATCACTCCTCTACCGAGTCTATTACTCCTTCCTCGTCAAGATCCACTTCCCCCTCTGGGAGTCCGATCCCAGTCCAACCCGTTCCTAAGCCTAGAGCACCCGCCAGGACAGGGATTGCTCCTAGGCAATTGAGAACCCCTCCTCACTCTCCTTCCCCAACCCTATCCCCAATCCCGGTGGACTCTACCCGAGGTGCCCCCGCCCTAAGCGGCACGGCGGGTAACCTGGACTCCACCAGGTATATGGACCTAGAGTCCACCAGACCGCATCACGCGCCTAAGACAAATCCTAAGCCCTCTACCTCCTATGCTGCTATGGCAGCTAGGCCGGGTATCCCATCCATCCAGAGGACATCCCAATCCTCTCATGTCCCTCCCCCGAGGCCGAAGGGTCGTGCCCAGGAGGAGCTGCGCCGACATCCGCCAATAATGGTGGAGGCCCTCCCTAATTGGTCCCGCCACATGGCGGCCATTAGGGAGCGCCTTGGCCGCGCCCCATCGGCGCGACCCTTCGGCGCCGGTTTTAGATTCCTGCCGACGTCGGTTGAGGAATACAGGGCGGTCCAGGCCTACCTGTCGGAGGCCTCTGCCAGGGATAGTACCATTAAATGGTACTGCTATGCCCTGACAGGGGAGATTCCGACCAAGGTGGCTGTCCGGGGCCTCCCTGCCGATACTGACGCGGCAGAAATAACCGATGCCCTGAAGGAGCTGGGGTTCCCGGCTCGTCACGCCAGGTGCATCAGGTCCCAGAGAGGGCGCCCGGGCTGCGTGTTTTACGTAGCCTTGGACCACCTCTCGAAGGACGACCTCGCCCGCCTGTACGCAGTCAATGAACTGCTGTACTTGCCGGGGGTGACAGTTGAGGGATGGCGACCAACCCGCGGGCCTGCGCAGTGTCATCGCTGCCAGGCCTTCGGGCACGCCTCGAACAATTGTCACCGAGCGGTCCGTTGTGTTCGATGTGCCGGGGAGCACGTCGTAGCGGACTGCCCGAGGCCGAGGGACGGCCCATTCTCCTGCGCCAATTGCGGGAAGGACCACGCCGCCGTTGATAGGCGGTGTCCGGTCTACCGCAAGAAGGCCAGGATGATGGGAGTAACCGTCCCTCCTCCTGCGCCAATGGTGCCTCGACCCGGGAACACAGCTCTTCCCTCTGTAGCTCCCATTCCAAAGGGGAAGGGGAAAGGGAAAGGGAAATCCTCCCAGCCCCAACCCCTCCCCTGTCCTCACCCATCCCCCCTGCCGTCTCAGTGGAGGCCAATCCATCAGCGGCAACGCTGA
Protein
MSGGNPPPTISTPGPSHKGRQAMPEVQLPTPTPAIRMAPMGPGAGSSAGPSAAARGPLRIVPVESNFPTSADPSGPSRPRKKARSESDRGSSGDQDKRPRIGPSSRSEGEESVTTSTDHSSTESITPSSSRSTSPSGSPIPVQPVPKPRAPARTGIAPRQLRTPPHSPSPTLSPIPVDSTRGAPALSGTAGNLDSTRYMDLESTRPHHAPKTNPKPSTSYAAMAARPGIPSIQRTSQSSHVPPPRPKGRAQEELRRHPPIMVEALPNWSRHMAAIRERLGRAPSARPFGAGFRFLPTSVEEYRAVQAYLSEASARDSTIKWYCYALTGEIPTKVAVRGLPADTDAAEITDALKELGFPARHARCIRSQRGRPGCVFYVALDHLSKDDLARLYAVNELLYLPGVTVEGWRPTRGPAQCHRCQAFGHASNNCHRAVRCVRCAGEHVVADCPRPRDGPFSCANCGKDHAAVDRRCPVYRKKARMMGVTVPPPAPMVPRPGNTALPSVAPIPKGKGKGKGKSSQPQPLPCPHPSPLPSQWRPIHQRQR

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
544
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00046
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00040
outside
1  -  544
 
 

Population Genetic Test Statistics

Pi
358.595959
Theta
207.188676
Tajima's D
2.518829
CLR
2.486879
CSRT
0.948502574871256
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号