SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14708
Annotation
PREDICTED:_uncharacterized_protein_LOC101747137_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.783
 

Sequence

CDS
ATGGCGCAGGCGATAGCGAACGAATTGGACATCGCGGTCGGCAGAAGGACGTACTGGACTGACTCCAGTACAGTTCTGACATGGATAAAGACCGACCCACGCACGTTCAAACCTTTCGTTGCGCACCGACTCGCCGAGATAGAAGAGTCAACGAAGCCCCAAGAATGGCGATGGGTGCCTGGCTCGCAGAACCCAGCAGACGACGCAACTAGAGAGGCGCCGGCGGATTTCGACCACACGCATCGGTGGTTTAATGGACCCGAGTTCCTGATGTGGGATGAATCGCGCTGGCCCAAGCCGCGAACATTCAAGCAAGAACCGTCTGGAGAAGAGAAAGAGGCCTACCTGGTCGCCACGGCGAGGACCGCTGACGCTCAACCCACGCCCGATCCGCACAGATTCTCGAGCTGGGTCAGGTTATTGAGAGCAACAGCCAGGGTCCTCCAATTTATCGAGCTGTGTCGACCCCGGAAGGAGAGCGCCTGCGTGTCCAGACAATTGGAGCAGCAAGATCCCACGTGGAGGACGACGCGAGCGAAGCAGCCCCGATCAACATGGAAGATAAGGACTCCAGAAGCACCTACAGAAGCGTGGCTGCCGCTCGATCCGCCCCACTTGAAGAAGGCGGAGAAGATCCTACTGAGAAGCAGCCAAGGAGAGAGCTTCGGTGAAAAAGATCCCGAACGTCACCCCAAGTTGCGACGGCTCGACGTCGTGATGGAAGATGGCCTGTTGCGCCTGCGCGGACGTATTGACGCAGCGCAATACATAGATGCAGGCTGCAAGCAACCGATCGTGCTGGACGGGAAGCACGTGATAGCGAGATTATTGATCAAACACTATCACGAGGCGTTCCAGCACGGTAACCACGCAACGGTGATGAACGAGATATAA
Protein
MAQAIANELDIAVGRRTYWTDSSTVLTWIKTDPRTFKPFVAHRLAEIEESTKPQEWRWVPGSQNPADDATREAPADFDHTHRWFNGPEFLMWDESRWPKPRTFKQEPSGEEKEAYLVATARTADAQPTPDPHRFSSWVRLLRATARVLQFIELCRPRKESACVSRQLEQQDPTWRTTRAKQPRSTWKIRTPEAPTEAWLPLDPPHLKKAEKILLRSSQGESFGEKDPERHPKLRRLDVVMEDGLLRLRGRIDAAQYIDAGCKQPIVLDGKHVIARLLIKHYHEAFQHGNHATVMNEI

Summary

EMBL
AF530470    AAQ09229.1    AB042119    BAA95570.1    AB042118    BAA95569.1    + More
RSAL01000375    RVE42106.1    JTDY01001530    KOB73634.1    NWSH01008670    PCG62455.1    KQ459986    KPJ18861.1    JTDY01006922    KOB65592.1    LNIX01000004    OXA56382.1    AAZX01023278    LNIX01000019    OXA44812.1    OXA55408.1    LNIX01000039    OXA39294.1    JTDY01002261    KOB71779.1    OXA44855.1    LNIX01000015    OXA46575.1    ODYU01003174    SOQ41584.1    LNIX01000007    OXA52015.1    LNIX01000003    OXA57597.1    JXUM01151198    KQ571164    KXJ68235.1    GEBQ01015876    JAT24101.1    JXUM01013493    KQ560378    KXJ82704.1    GGFL01001842    MBW66020.1    GGFJ01000306    MBW49447.1    GGFJ01000487    MBW49628.1    JXUM01127084    KQ567147    KXJ69602.1    GGFJ01000471    MBW49612.1    GGFJ01000470    MBW49611.1    GGFL01001682    MBW65860.1    GGFJ01000432    MBW49573.1    GGFJ01000333    MBW49474.1    JXUM01146045    JXUM01146046    APCN01002024    GAMC01017930    JAB88625.1    RSAL01000010    RVE53755.1    JXUM01109099    KQ565290    KXJ71123.1    JXUM01136032    KQ568367    KXJ69026.1    JTDY01000902    KOB75497.1    GEHC01000914    JAV46731.1    JXUM01016534    JXUM01056823    KQ561926    KQ560461    KXJ77135.1    KXJ82302.1    LNIX01000018    OXA45362.1    JXUM01005879    KQ560203    KXJ83865.1    JXUM01111221    KQ565482    KXJ70922.1    GEHC01000872    JAV46773.1    GAMC01020598    GAMC01020596    GAMC01020592    JAB85959.1    GEHC01000913    JAV46732.1    AB110069    BAD01590.1    BAD01589.1    GAMC01020594    JAB85961.1    GEZM01052587    JAV74399.1    GEHC01000967    JAV46678.1    D83207    BAA19772.1    GEZM01052586    JAV74401.1    LSMT01000075    PFX28896.1    GAKP01020709    JAC38243.1    AJVK01001938    GCES01140631    JAQ45691.1    GCES01132273    JAQ54049.1    GCES01134385    JAQ51937.1    GCES01111900    JAQ74422.1    GGFL01005193    MBW69371.1    GCES01110894    JAQ75428.1    GDQN01005965    JAT85089.1    JXUM01083542    KQ563383    KXJ73941.1    HAEJ01014775    SBS55232.1    GGFJ01001462    MBW50603.1    GGFJ01001476    MBW50617.1    GGFJ01000302    MBW49443.1    GEHC01000955    JAV46690.1    GGFJ01000218    MBW49359.1    GBYX01459353    JAO22206.1    JXUM01009840    KQ560293    KXJ83223.1    AAGJ04142769    AAGJ04142770    JXUM01130316    KQ567562    KXJ69370.1    GBYX01459357    JAO22202.1    LSMT01000554    PFX16342.1    KL367545    KFD65082.1    JXUM01144298    KQ569759    KXJ68523.1    GAMC01005008    JAC01548.1    JXUM01008943    KQ560272    KXJ83402.1    GDIP01036233    JAM67482.1    GDIP01004568    JAM99147.1    MRZV01000303    PIK53060.1    GDIQ01114015    JAL37711.1    GBYX01459355    JAO22204.1    LSMT01000016    PFX33015.1    GCES01111762    JAQ74560.1    GCES01112266    JAQ74056.1    MRZV01000348    PIK51982.1    GCES01103975    JAQ82347.1    AJWK01027898    AAGJ04091218    AAGJ04001285   
Pfam
PF03564   DUF1759        + More
PF05380   Peptidase_A17
PF00665   rve
PF18701   DUF5641
PF17921   Integrase_H2C2
PF05585   DUF1758
PF01565   FAD_binding_4
PF09129   Chol_subst-bind
PF00078   RVT_1
PF00628   PHD
PF00069   Pkinase
Interpro
IPR040676   DUF5641        + More
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR041588   Integrase_H2C2       
IPR008737   Peptidase_asp_put       
IPR001995   Peptidase_A2_cat       
IPR001878   Znf_CCHC       
IPR001611   Leu-rich_rpt       
IPR032675   LRR_dom_sf       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR016164   FAD-linked_Oxase-like_C       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR000477   RT_dom       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR036305   RGS_sf       
IPR000961   AGC-kinase_C       
IPR000719   Prot_kinase_dom       
IPR000239   GPCR_kinase       
IPR017441   Protein_kinase_ATP_BS       
IPR011009   Kinase-like_dom_sf       
IPR016137   RGS       
IPR036875   Znf_CCHC_sf       
IPR019786   Zinc_finger_PHD-type_CS       
IPR001841   Znf_RING       
IPR000253   FHA_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001969   Aspartic_peptidase_AS       
IPR036179   Ig-like_dom_sf       
IPR013783   Ig-like_fold       
IPR003599   Ig_sub       
IPR007110   Ig-like_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF56176   SSF56176       
SSF55103   SSF55103       
SSF57903   SSF57903       
SSF56112   SSF56112       
SSF48097   SSF48097       
SSF57756   SSF57756       
SSF48726   SSF48726       

Ontologies

Topology

Length:
297
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00181
Exp number, first 60 AAs:
0.00181
Total prob of N-in:
0.02976
outside
1  -  297
 
 

Population Genetic Test Statistics

Pi
427.375013
Theta
225.777096
Tajima's D
2.593275
CLR
0.180323
CSRT
0.952302384880756
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号