SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14675
Annotation
PREDICTED:_uncharacterized_protein_LOC105388498_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 4.15
 

Sequence

CDS
ATGGATAAACTTGAACTTCAATCAACTTGTTTCGAGAATATCAAGACTTTGTGTACAAACTACCGCAAAGATTCTTCGTCTCGAAAAACTGAAGAGTACCTCAACATACGTTTGTCATCTTTGGAAGAACAGTGGAGAGACTTCGAGGCGAGAAATGCCTTATTACTACTGGAACTGGAAGACAAAACTATACATTATTTCTCTGAAGACGTTTACAACAAAACTAAAGAAATGTATCTAGCAACAAAAACAGACATAAATAACAGACTTAAATACTTGAAACAGCAAAAACATAGTGTGAATTTTGATTTAAGTGACATTTCTGTTGACTACACTCAAGACTGCGAGGACGGAAAATCTGAAAAAATACAACAACTTTTAAATAAACAAGAATGCAATTTTAATGCGATTTGTCATGCATTGTCTAAAATTGACATCATTAGAACTAGTGAAAAGTGGGAGCTGGAAGATAATTTTAACATTTTAAAATCGAAGTGGGAGTCCATCGACAAACTGCACTGGGAAATTGACTTTCAGCTGAAGGGGTCTAACGATCACTATTACCGGATGTACTCAGATATGGAAGAAAAATATGATGAATTGAGAAAACAACTTCAATCTAAAATTTGGTCGAATGCACACTATCAGCAGTCGACACCGAGAATGGAATTACCTGATTTTTACGGAAACTACAGTAAGTGGATCTCTTTTAAGGACCTGTTTCTCGAAACCATCCATAACAACCCAACAATTAACAAAGCGCAAAAAATGAAACACCTGAAAACCAAATTGAAGGGGGAAGCAGAAAGTCTGGTACAGCATTTATCCGTCTGTGCTGAAAACTACAACTCCTGCTGGGATATTTTAGTGCAACGGTATGATAATCGCCGCCTACAATTTTCATCGTTTTTCAACACAATGATGAGTCTCCCTGTTATACATCAACCCGACGCTAACAATCTCAAGAAAATGCATGACGTCATTAAGGAATGCATGAACGGCATAGCTAACATCGGGCTGGATACGACAACGTGGGATCCAATGATCGTGCATTTAATGTTACCAAAATTAGATTCAACAACTTTAAATGATTATATGAACGAAATCCGCGATCACAGAGAATTACAAAACTTGCAAGATTTTTTATATTTTTTGGAGTGCAAGTTTATGGCATATGAAACTGCAAAATCAACAAAATCTGTAAAAAATACCACTTCCGAATATACATCTCATTGGAAACCGGCTAACAACAAACAACCTGTAAAAAAATTTACATATGACTCTAAGAAAACTTATAACTATCACGCTACTTATGGAAAATGCCCGAATTGTAATGGAAATCATGTTTTAATGCAATGTGCTAAATTTATTAACATGGATACTGCACAGCGAAACCACACTGTTGCGAAATTGAAACTCTGCAAAAATTGTCTCTATAGCCACAATAACGAAGAATGTAAATCAGCGAAAACGTGTAAGGAGTGTAACATGAAACATCATACCATGTTGCACAACGTGAACTGGAAAATTCCAGCGAATGGTAAGAATAACTTTGGACAACAAGCCTCCTCTTCTCAGCAACAAGCTTCGAATCACTTATCATCGGATAAAACTGAAATTTTACTAACTACAACTCTACTGAAAATAAAGGCTTATGATGGCACTTATGTAAAACTTAGGGCCCTCTTGGATCAGGGCTCGCAAGTAAACTTAATAACAGAAAATGCCGCTCAGGTATTACGCCTGCCGAGGAAAAGGTTCGCTGCTACCATCTCGGGGGTTGGTTCAGTATCTGGTGATTGCAGGGGTCAACTAAACTTATCTTGTAAATCAATAAACTCTGAATACGACTTCGAAATACAAGCACTTATAATGAAAAAACTTACAAATAACTTACCGAATGCTACTTTCGAAAAATCGAACTGGCCTCATTTGGAAAACTTAAAGCTGGCTGATCCTGACTTCAACATCTCTCGCCCCATCGACTTACTACTGGGTGCCGATGTTTATTCAGATATTATACTCAATGGAGTTTTGAAAGGAAGCTGTCAATCCCCTGTGGCACAACAGACACATCTAGGATGGATCCTATGTGGGAAAATGAAAACGTTTAATTGCCACGTGACCTTGGTGAACTTTGATGAATTAACAAAGTACTGGGAGAGCGAAGAAATACAAAATTCTGAAGATATTTCCAAGGACGATCAGTGTGAACAATTTTATTCGGAAACAGTACAACGTGCTCCCGACGGAAAATATATTGTGAAGATGCCACTCCGCCCTGACCTTAAAGAAAAATTAGGCCGCCCAGACGGTGAAGCTGGTGTCCCGGAATACCCCGCTGGACCAGAACCAGCCTGCCGGGTCGGGACGCTGGTTGACGAATTTCAACCATTGGGGGACCACTAG
Protein
MDKLELQSTCFENIKTLCTNYRKDSSSRKTEEYLNIRLSSLEEQWRDFEARNALLLLELEDKTIHYFSEDVYNKTKEMYLATKTDINNRLKYLKQQKHSVNFDLSDISVDYTQDCEDGKSEKIQQLLNKQECNFNAICHALSKIDIIRTSEKWELEDNFNILKSKWESIDKLHWEIDFQLKGSNDHYYRMYSDMEEKYDELRKQLQSKIWSNAHYQQSTPRMELPDFYGNYSKWISFKDLFLETIHNNPTINKAQKMKHLKTKLKGEAESLVQHLSVCAENYNSCWDILVQRYDNRRLQFSSFFNTMMSLPVIHQPDANNLKKMHDVIKECMNGIANIGLDTTTWDPMIVHLMLPKLDSTTLNDYMNEIRDHRELQNLQDFLYFLECKFMAYETAKSTKSVKNTTSEYTSHWKPANNKQPVKKFTYDSKKTYNYHATYGKCPNCNGNHVLMQCAKFINMDTAQRNHTVAKLKLCKNCLYSHNNEECKSAKTCKECNMKHHTMLHNVNWKIPANGKNNFGQQASSSQQQASNHLSSDKTEILLTTTLLKIKAYDGTYVKLRALLDQGSQVNLITENAAQVLRLPRKRFAATISGVGSVSGDCRGQLNLSCKSINSEYDFEIQALIMKKLTNNLPNATFEKSNWPHLENLKLADPDFNISRPIDLLLGADVYSDIILNGVLKGSCQSPVAQQTHLGWILCGKMKTFNCHVTLVNFDELTKYWESEEIQNSEDISKDDQCEQFYSETVQRAPDGKYIVKMPLRPDLKEKLGRPDGEAGVPEYPAGPEPACRVGTLVDEFQPLGDH

Summary

EMBL
KZ150641    PZC70422.1    KZ150005    PZC75227.1    JTDY01001118    KOB74820.1    + More
KZ149989    PZC75621.1    NWSH01000402    PCG76662.1    NWSH01000070    PCG79985.1    KZ150008    PZC75149.1    ODYU01005059    SOQ45565.1    ODYU01006730    SOQ48837.1    ODYU01012875    SOQ59395.1    JTDY01001277    KOB74321.1    LBMM01011051    KMQ87060.1    GEZM01060253    JAV71158.1    GEZM01060254    JAV71154.1    LBMM01008464    KMQ88855.1    LBMM01017223    KMQ84153.1    ODYU01008608    SOQ52337.1    LBMM01011516    KMQ86784.1    LBMM01009746    KMQ87900.1    LBMM01009898    KMQ87805.1    LBMM01015575    KMQ84755.1    KQ977080    KYN05933.1    LBMM01010417    KMQ87475.1    ODYU01008829    SOQ52773.1    LBMM01012568    KMQ86144.1    LBMM01017818    KMQ83962.1    LBMM01009645    KMQ87967.1    GAMC01020546    JAB86009.1    KQ460036    KPJ18393.1    KQ976954    KYN06860.1    QOIP01000009    RLU19026.1    LBMM01004572    KMQ92278.1    LBMM01017192    KMQ84171.1    KQ978058    KYM97736.1    JTDY01004853    KOB67675.1    LBMM01010405    KMQ87487.1    GAMC01003146    JAC03410.1    QOIP01000012    RLU15613.1    GFTR01008874    JAW07552.1    ABLF02028666    ABLF02066713    KQ981619    KYN39239.1    JTDY01001331    KOB74176.1    LBMM01009284    KMQ88248.1    KQ977963    KYM98425.1    ABLF02022040    ABLF02056888    KQ982204    KYQ59009.1    KQ978855    KYN27942.1    GGMR01018506    MBY31125.1    QOIP01000003    RLU24798.1    GGMR01014413    MBY27032.1    LNIX01000026    OXA42254.1    ABLF02016109    ABLF02016113    KQ981002    KYN10407.1    KQ979016    KYN24380.1    GGMR01020322    MBY32941.1    GGMS01000724    MBY69927.1    GGMS01001896    MBY71099.1    KQ458793    KPJ04955.1    GGMS01005792    MBY74995.1    KQ460545    KPJ14069.1    AJWK01022907    AJWK01000239    AJWK01000240    LNIX01000018    OXA45284.1    LNIX01000063    OXA37200.1    LBMM01009551    KMQ88039.1    LNIX01000044    OXA38660.1    LNIX01000001    OXA61293.1    LNIX01000007    OXA51382.1    ABLF02023723    LNIX01000003    OXA58579.1    LNIX01000002    OXA60848.1   
Pfam
PF05585   DUF1758        + More
PF03564   DUF1759
PF17921   Integrase_H2C2
PF00230   MIP
PF12259   Baculo_F
PF05380   Peptidase_A17
PF00665   rve
PF18701   DUF5641
PF00078   RVT_1
PF13843   DDE_Tnp_1_7
PF03175   DNA_pol_B_2
PF02145   Rap_GAP
Interpro
IPR005312   DUF1759        + More
IPR008737   Peptidase_asp_put       
IPR029060   PIN-like_dom_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001995   Peptidase_A2_cat       
IPR001584   Integrase_cat-core       
IPR000425   MIP       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR040676   DUF5641       
IPR023271   Aquaporin-like       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR022048   Envelope_fusion-like       
IPR000477   RT_dom       
IPR029526   PGBD       
IPR001878   Znf_CCHC       
IPR000727   T_SNARE_dom       
IPR004868   DNA-dir_DNA_pol_B_mt/vir       
IPR001969   Aspartic_peptidase_AS       
IPR000331   Rap_GAP_dom       
IPR035974   Rap/Ran-GAP_sf       
SUPFAM
SSF88723   SSF88723        + More
SSF53098   SSF53098       
SSF81338   SSF81338       
SSF50630   SSF50630       
SSF111347   SSF111347       

Ontologies

Topology

Length:
802
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00228
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00016
outside
1  -  802
 
 

Population Genetic Test Statistics

Pi
390.014651
Theta
196.279565
Tajima's D
3.122352
CLR
0.182687
CSRT
0.983400829958502
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号