SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14653
Pre Gene Modal
BGIBMGA003354
Annotation
hypothetical_protein_ANCDUO_02957_[Ancylostoma_duodenale]
Full name
ATP-dependent DNA helicase      
Location in the cell
Nuclear   Reliability : 2.634
 

Sequence

CDS
ATGCCACGCAAACGTAAATCCAATCTAAGCCGTAGTTCTAGCAGAGCTCGAACTGCAAAAGTTGCTAGAAGCCAAGAATCTGAAGAGCAGACTCAGACGCGTCAGATGTTAGATTCTCAGCGTCATGCGACTCAAAGAGCTTCTGAGACCTATACGCAGACTCAAGCCCGTAGGACCTTAGATGCTGAGCGCCACGCATCTCAAAGGGCCTCTGAGACGTTTACACAGACTCAAGCCCGTCAGGCCCTAGATGCTGAACGCCACGCATCTCAAAGAGCCTCTGAGACGTTTACGCAGACTGAGACCCGTCAGGCCCTGGATGCTGAACGCCACGCATCTCAAAGGGCCTCTGAGACCTATACGCAGACTCAAGCCCGACAAACCTTAGATGCTGAGCGCCACGCATTTCAAAGGGCCTCTGAGACGTTTACGCAGACTCAGGCCCGTCAGACCCTGGATGCTGAACGCCATGCATCTCAAAGAGCTGCTGAGACAGTGGAACAGACTCAGACACGTCGAGTTTTAGATGCCGAACGTCACGCGCAATTGATTGCGGCAGAGACTGACGAAGATTCACAAAGACGACGTCTTTTAAATGCTGAACGGCAGGCAGAAAGAAGACGTACGTTTTCAATGAGTACGTGGGAGGCATTTAATGGTGCCGCTTTTGAGTATGACCCTTTGATCGACTATGTTAATCACCGATTGGTTATCATTGGGAGAATGGATAAAAAATGCAGATATTGTGAAGCACTGAAATGGAAAGAAGAAACTCCAGCACTAGAAAGAATGCCGGGAGAGGATTATAGGTTGGTGATGCACCCCGATCGCACACCAAGTGGGGAACATGAAAGGCGGTATAATGCACCGTTAATAAATGAAGTCGCAGCCTTGGTTACAGGCGAACAGTTTGCTTTCCGTGATATAGTTTTACAGGCCCGAGATGACACGTTAACCAGGGTGCCTGATACTCATAAATTTTATGATGCGTTGCAATATCCGATCATATTTAGTAAGGGACAAGAGGGGTACCACTTTCAAGTTCCTCAAATTAATCCTGTAACAGGTCTTCCCTTGCATAACAAAAAGGTTTCATGCATGGATTTTTATGCCTACAACATGATGATACGAGAAAACAACTTTAACATTGTACAAAGATGCAAGCAACTGGCCAATCAGTTTTACGTTGACATGTACGTTAAAGTTGAAAGCGAGAGGTTACGGTACATATCATTAAATCAAACTAAACTAAGAGCAGAGAATTACATCCATCTTCAAGACGCTGTGGCAAATGACGCTAATTTAAATCCAAATAACTTAGGTCGTATGGTCATTTTACCATCTTCATTTGTAAATAGCCCGCGGTACTTACACGAATATACTCAGGACGCGTTTGTTTATGTGCGTACACATGATCGCCCTGACTTATTCGTCACCTTTACTTGCAACCCAGCCTGGCCCGAAATAGTCAATCAGTTGATGCCGGGGCAAAGCGCAATAGATAGAGATGATGTAGTCGCAAGAGTTTTTAGACTAAAAGTTAAAAAACTAATGGATGTGATTAATAAAGGCCGAGTGTTCAGAGAAGCGCGCTGCTTTATGTACTCCGTCGAATGGCAGAAACGTGGACTGCCACATGTCCATATATTATTGTGGTTAAAAGATAAGTTACGACCCGATCAAATAGATAACATAATCAGCGCTGAAATACCGGATCCTAACATTGACAAGACTCTCCATGACGTTATTGTAAAAAATATGATTCACGGTCCATGCGGACCCGAAAATCCACAGTGCCACTGCATGAAAGACGGAAAATGCACAAAAAAATTTCCTCGCAAATTACAAGAGCAAAATCCCAATGTCACGTACAGTGATTTAATTTACAATGAGGGTCTGACAAAAATTGAAGACCAGGTTAAAACAATTTCTAGAAAGGATTTATCAGATTATGGAATGATCAGACCACAGAGAACCGAGGAAATCAGTAGCGATTTAATACGGGAACTAGATTACGATACTGCTTCCTTACAACAACAATTGACAGAGTCTGTTCCACGTTTGATCCCAGAACAAAGGTTAGTATTTGACAATGTTTTCAAAAAAATCGAAGATGGCGAAGGTGGTTTGTTATTTTTGGATGCTCCCGGAGGCACGGGAAAAACCTTTCTTTTAAACTTGCTTTTAGCGCAAATCCGAAAAGATAAAGGAATTGCTGTAGCAGTTGCCTCTTTCGGAATAGCCGCCACTCTGCTCAATGGTGGTCGAACGGCACATTCGGTGCTTAAACTGCCATTAAACTTAGCCCATGAAGAAATGCCAGTCTGTAATATAAGTAAAAACAGCGAGCGTGGACGTATGTTGCAGCAATGTAAATTATTAGTTTGGGATGAGTGTACTATGTCCCATAAAAGAGCAATTGAAGCTCTAGATCGGACTTTGAAAGACATCAAGAGTAATCCAAATATCATGGGGGGGATGGTGGTACTTTTAGCGGGCGATTTTAGACAGACTTTGCCGGTTATCACTAAAGGCACCCCTGCAGATGAAATAAATGCGTGTTTAAAAGCGTCAACGTTATGGGTGCACGTAAAAACGTTTAGTCTGTCTACAAATATGAGAGTGCAACTACACAATGATGTACAATCTGGACAATATGCTGCTGCTCTTCTTAAAATTGGAGAAGATCGTATGGCAAAGGATGGTAATGGCATGATTACATTGGATCGTGAATTCTGCAATGTTGTGCATAATCCAGATGATCTAAATAACTTCGTCTATAGCGAACTGCTAACTAATATGAGGAATAGAGACTGGTTATGTGAAAGAGCAATTTTAGGGCCGACGAATGAAATGGTGGGACAGATAAACGAGCAAATTATGTCACGTGTGGAAGGTGATATTGTTGAGTTTCTCTCTGTAGACACTGTAATGGATACTGAACAAGTAACATCATACCCTGTAGAATTTCTTAATTCTTTAGAACTGTTGGGAGTACCTTCACACAAACTGAGGCTGAAAGTAGGCGTTACTGTCCTTTTAATTCGGAATTTAGATGCACCAAGACTGTGTAATGGCACACGGTTGCAAGTGACACACCTCGGTCGCAATATTGTAAAAGCAATCATTATGACTGGAATGGCAAAAGGAGAGAACGTTTTAATCCCCCGTATACCCATAATTCCGACAGATTTGCCATTCCAGTTTAAGAGATTACAGTTTCCGCTGAAAATCGCATTCGCTATGACGATAAATAAAGCTCAGGGGCAAACATTAAAAGTAGCCGGCATTAATTTAGAAAAGAGTTGTTTTTCTCACGGACAATTATACGTGGCTTGCTCACGTGTTTCAAGTCCACAGAATCTCCATGTGTTGGCCAGAGAGGGAAAAACAAAGAACATAGTTTACAAAAATGTACTACAGTAA
Protein
MPRKRKSNLSRSSSRARTAKVARSQESEEQTQTRQMLDSQRHATQRASETYTQTQARRTLDAERHASQRASETFTQTQARQALDAERHASQRASETFTQTETRQALDAERHASQRASETYTQTQARQTLDAERHAFQRASETFTQTQARQTLDAERHASQRAAETVEQTQTRRVLDAERHAQLIAAETDEDSQRRRLLNAERQAERRRTFSMSTWEAFNGAAFEYDPLIDYVNHRLVIIGRMDKKCRYCEALKWKEETPALERMPGEDYRLVMHPDRTPSGEHERRYNAPLINEVAALVTGEQFAFRDIVLQARDDTLTRVPDTHKFYDALQYPIIFSKGQEGYHFQVPQINPVTGLPLHNKKVSCMDFYAYNMMIRENNFNIVQRCKQLANQFYVDMYVKVESERLRYISLNQTKLRAENYIHLQDAVANDANLNPNNLGRMVILPSSFVNSPRYLHEYTQDAFVYVRTHDRPDLFVTFTCNPAWPEIVNQLMPGQSAIDRDDVVARVFRLKVKKLMDVINKGRVFREARCFMYSVEWQKRGLPHVHILLWLKDKLRPDQIDNIISAEIPDPNIDKTLHDVIVKNMIHGPCGPENPQCHCMKDGKCTKKFPRKLQEQNPNVTYSDLIYNEGLTKIEDQVKTISRKDLSDYGMIRPQRTEEISSDLIRELDYDTASLQQQLTESVPRLIPEQRLVFDNVFKKIEDGEGGLLFLDAPGGTGKTFLLNLLLAQIRKDKGIAVAVASFGIAATLLNGGRTAHSVLKLPLNLAHEEMPVCNISKNSERGRMLQQCKLLVWDECTMSHKRAIEALDRTLKDIKSNPNIMGGMVVLLAGDFRQTLPVITKGTPADEINACLKASTLWVHVKTFSLSTNMRVQLHNDVQSGQYAAALLKIGEDRMAKDGNGMITLDREFCNVVHNPDDLNNFVYSELLTNMRNRDWLCERAILGPTNEMVGQINEQIMSRVEGDIVEFLSVDTVMDTEQVTSYPVEFLNSLELLGVPSHKLRLKVGVTVLLIRNLDAPRLCNGTRLQVTHLGRNIVKAIIMTGMAKGENVLIPRIPIIPTDLPFQFKRLQFPLKIAFAMTINKAQGQTLKVAGINLEKSCFSHGQLYVACSRVSSPQNLHVLAREGKTKNIVYKNVLQ

Summary

Catalytic Activity
ATP + H2O = ADP + H(+) + phosphate
Cofactor
Mg(2+)
Similarity
Belongs to the helicase family.
EC Number
3.6.4.12
Pfam
PF14214   Helitron_like_N        + More
PF05970   PIF1
Interpro
IPR027417   P-loop_NTPase        + More
IPR025476   Helitron_helicase-like       
IPR010285   DNA_helicase_pif1-like       
SUPFAM
SSF52540   SSF52540       
PDB
5FHH     E-value=8.87618e-20,     Score=243

Ontologies

Topology

Length:
1141
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.95458
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00029
outside
1  -  1141
 
 

Population Genetic Test Statistics

Pi
352.228829
Theta
222.457772
Tajima's D
3.661507
CLR
0.159389
CSRT
0.995700214989251
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号