SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14651
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.988 Nuclear   Reliability : 1.716
 

Sequence

CDS
ATGATTGCACACCGCAGAACCAGGCCCCTAGTCCCCGGCGGCCCCGCTATTCCTGGTTACGGTAGCGGCCATGGTAACGGCGGGGCAAGGGGTGCTAAGAATCCCCGGCAGAGATCCGGCTACCACCCCCCTTCACAACGACAACTGGCCCTGGTGACATACAACGTGCGCACTTTGAGGTTGGACGAGAAGCTAATAGAGCTGGAAGAAGAAATGAACAAGTTGCGCTGGGACGTTATTGGTTTATCGGAGATCCGAAGAGAGGGGGAGGATACGAAAACCTTACAGTCCGGCCACTTGTTCTACTACCGGGAGGGAGAACAGAAGTCCCAAGGTGGTGTTGGGTTTATCGTCCACAAATCTCTCATAAACAACATTGTGGCCATCGAAAGTGTGTCGAGTAGGGTAGTATACCTTGTCCTCAAAATCTCAAAGCGGTATTCGCTGAAGATTGTACAGGTATACGCCCCATCAACGTCACATCCAGGCGATGAAGTGGCAGCTACGTATGAGGACATTAGTAGGGCCATACGTAACTCCCAATCACATTTTACCATTGTTATGGGAGATTTCAATGCAAAACTGGGCCGTAGAGGCGATGATGAGTTGAAAGTGGGGCCATTTGGATTTGGGCAGCGGAATCCCAGAGGACAGATGCTGGCGGACTTTATGGAGAAGGAAGGACTCTTTATGATGAATTCTTTCTTCAAGAAGCCGCCACAACGGAAATGGACCTGGTTGAGTCCCGACGGTGTAACAAGAAATGAAATCGATTTCATCATGAGCACCAACAGACAGATATTCAACGATGTCTCTGTGATCAACAGTGTTAAAACAGGAAGTGATCACCGAATCGTCAGAGGCATGTTGAATATCAATGTCAGACTGGAAAGATCGCGTCTGATGAAGTCAACGCTTCGACCGTCGAATGCACAAATCCAAAACCCCGAGAGCTTTCAACTCGAATTGGCTAATCGCTTCGAATGGCTAAACAGCTGCGCATCAGTGGACGATGTAAACAGCAGGCTGAGACGCTTGCAAAGCCAGCTGACGAAGCTGAAGACCGAAGATGGACGTGTAACGTCGAATAAGTCAGAGGTCCTGCGGGAGATAGAAAGGTTCTACGGGCAGCTGTTTACCTCGGTCTCAGCTGAACCGCAAGGTTTAGCTGCAGACCCTAGAGCCAAGCTAACCCGACACTACACCGAAGACATCCCGGACATCAGCCTGTACGAGATTAGGATGGCTCTCAAACAGCTTAAGAATAACAAGGCACCGGGCGAGGATGGAATTACTACGGAGCTTCTGAAAGCGGGCGGGACGCCGGTACTGAAAGTCCTTCAGAAGCTCTTCAATTCCTCTTTGCTCGATGGAAAACCGCCACAGGCATGGAGCAGGGGTGTTGTGATCCTGTTCTTCAAAAAAGGTGACAAAACCTCATTGAAGAACTATAGGCCCATAGCACTGCTGAGCCATATCTACAAGCTGTTCTCGAGAGTCATCACGAAGCGTCTCGAACGCAGGTTTGATGACTTCCAGCCTACCGAACAAGCCGGTTTCCGAAAAGGCTACAGTACCATAGACCACATACATACGCTGCGGCAGATTGTACAGAAGACCGAAGAGTACAATCGGCCATTATGCTTAGCGTTTGTGGACTATGAGAAAGCCTTTGATTCCGTCGAAACATGGGCGGTCCTTAGATCTCTCCAGCGGTGCCGTATTGACCACCGGTACATCGAAGTATTGAAGTGTTTGTATAATAACGCCACCATGTCAGTCCGAGTACAGGAGCATTGCACGAAGGAAATCCCTGTAAAGAGAGGAGTGAGACAGGGAGATGTGATATCTCCGAAACTGTTTATCACTGCTCTGGAGGATTCCTTCAAGCTTCTGGAATGGCAAGGACTTGGCATCAATATTAACGACGAATACATCACTCATCTTCGGTTTGCCGATGACATCGTGGTCATGGCAGAGTCGCTGGAAGATTTAGGGCGTTTGCTCGGTGACCTCAGTAGGGTTTCTCAACAAGTGGGTCTTAAAATGAACATGGACAAAACAAAAATCATGTACAATGTCCATGTTGCACCCACCATAGTTACTGTTGGGAGCTCTACTCTTGAAGTTGTTGACGAATATATATACCTAGGACAGGCAGTCCGATTAGGTAGGTCCAACTTTGAGAGAGAGGTCAGTAGACGGATCCAACTCGGCTGGGCAGCGTTCGGTAAACTGCACAACGTCTTCTCGTCCAAAATACCTCAGTGTCTTAAGACAAAGGCGTACAACCAATGTGTGTTACCAGTGATGACTTACGGCTCGGAGACGTGGTGCTTCACTAGGGATCTTTTTAGAAGGCTCAAAGTCGCGCAGCGAGCTATGGAGAGGGCTATGCTCGGCATTTCTCTACGTGATCGAATCCGAAATGAGAAGATCCGTAGAAGAACGAAGGTTGCTGACATAGCCCGTAAAATTAGTGAACTGAAGTGGCAATGGGCCGGCCACATAGCACGAAGAGAGGACGGTCGATGGGGCAGAAAGATCCTGGAGTGGCGACCACGTACTGGCAAGCGCAGTGTGGACGGCCACCTACTAGATGGACCGACGACCTAG
Protein
MIAHRRTRPLVPGGPAIPGYGSGHGNGGARGAKNPRQRSGYHPPSQRQLALVTYNVRTLRLDEKLIELEEEMNKLRWDVIGLSEIRREGEDTKTLQSGHLFYYREGEQKSQGGVGFIVHKSLINNIVAIESVSSRVVYLVLKISKRYSLKIVQVYAPSTSHPGDEVAATYEDISRAIRNSQSHFTIVMGDFNAKLGRRGDDELKVGPFGFGQRNPRGQMLADFMEKEGLFMMNSFFKKPPQRKWTWLSPDGVTRNEIDFIMSTNRQIFNDVSVINSVKTGSDHRIVRGMLNINVRLERSRLMKSTLRPSNAQIQNPESFQLELANRFEWLNSCASVDDVNSRLRRLQSQLTKLKTEDGRVTSNKSEVLREIERFYGQLFTSVSAEPQGLAADPRAKLTRHYTEDIPDISLYEIRMALKQLKNNKAPGEDGITTELLKAGGTPVLKVLQKLFNSSLLDGKPPQAWSRGVVILFFKKGDKTSLKNYRPIALLSHIYKLFSRVITKRLERRFDDFQPTEQAGFRKGYSTIDHIHTLRQIVQKTEEYNRPLCLAFVDYEKAFDSVETWAVLRSLQRCRIDHRYIEVLKCLYNNATMSVRVQEHCTKEIPVKRGVRQGDVISPKLFITALEDSFKLLEWQGLGININDEYITHLRFADDIVVMAESLEDLGRLLGDLSRVSQQVGLKMNMDKTKIMYNVHVAPTIVTVGSSTLEVVDEYIYLGQAVRLGRSNFEREVSRRIQLGWAAFGKLHNVFSSKIPQCLKTKAYNQCVLPVMTYGSETWCFTRDLFRRLKVAQRAMERAMLGISLRDRIRNEKIRRRTKVADIARKISELKWQWAGHIARREDGRWGRKILEWRPRTGKRSVDGHLLDGPTT

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR029052   Metallo-depent_PP-like       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=1.95774e-06,     Score=127

Ontologies

Topology

Length:
871
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.04126
Exp number, first 60 AAs:
0.00223
Total prob of N-in:
0.00159
outside
1  -  871
 
 

Population Genetic Test Statistics

Pi
361.066548
Theta
216.00396
Tajima's D
2.257594
CLR
0.159505
CSRT
0.91740412979351
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号