SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14636
Annotation
PREDICTED:_piggyBac_transposable_element-derived_protein_4-like_isoform_X3_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.476
 

Sequence

CDS
ATGGAAAGATTTAACCTTATTGCAATTGAGGATTTGCCCGCTGGGGAACCGATAGAGCAGGCATTGACGGAGCGAAGTAAGCGTTCATGGAACCCCCGAAATTATGAACCTGACGGAGAGGACATTCCAGTAATTTTGTCTTCACCTGCGATTCCGCCATCACCGGCAATGTACGTTGAATGTGGCGGCAGTGGTACGAGCACGCCATCTTCTAGATATAATATACAGATTTCTGTACATGGCAGCCGTAGTCCTTCGCCGTCACATAAACGTGTGCGTCGATCGCTTTGCCCAGACCAAGAACATGATATTACGAACAGAGATTCTATTTCATCGCTACGTCGACCGCTACGAGACTCTGAAATTTGCTACTTGTTGCACTATGGAAGTGACGACGATTACAGCGATGATGAGAGCCAGAATGATAACGACGAAATCGTTCCCATGATTATCCCCCGGGCAGCTGGAATACTGATGGACACTCCGGACGACGAGGAGATTGAGATTGACACGGCGGCGGCAACTAAACCTCTTGTGACATCTTCCTCGCCTTCCATCATTTCAGCACCTACATCACCAGCTCGTGATACCGGTATGAAGCCTAGTCATTTTTTTGAATTTGACTGGGGAACTTTCCCTGACTCTCCTATACCGCCAACAGAAAGGCGTGAATCTTTTAAGGAACACTCTGGTCCCACTGTCGCTGTAAGTGACCCTTACGAGATTTTTAGACTAATTTGGGACCAGGAGTTCATGGAATTTATTGTGCAGGAAACAAATAGATATGCCCAACAATTAGCTGCTGAAATGTTGGACGGCGGGGAATTACAGGCCTCCAGTAGGATTACAGAATGGAAAGAAACCAATGTAGACGAGTTATTGGTGTTCTTCGGAATATTACTGGCGATGGGAATCGTCATAAAGAACCGGGTTGAAGAGTACTGGAATACGGAACAAAACATCTTCTCCACTCCAGGTTTCAAAGTATATATGTCGCTTAGGAGGTTCCAGTTACTCAGCAGGTGCTTACATTTTAATAATTCCGAGAACTTGAGAAACCTCAACCTGGATCCCTCACAGGCAAAGCTTTTTAAAGTGGAGCCTGTGATTAGCCATTTGAATTCCAAGTTCACGGAATTATATATAATGAAGCAGAACATTGCTTTAGATGAATCGCTGCTGCAGTGGAAAGGTTGGTTGAACATCAACCAATTTATTCCAAACAAAGCTGCAGCAGTGGGCATAAAAACTTACGAAATATGTGAGTCGCAGACGGGGTATTTATGGCGATTTAAAATCCATGCCCATAAGGCTTCGCCTACAGTCTCAGAGGCTGATCCATTCACAGCGAGTACACCGGCGTTGGTTCTTAACCTTATCAAAGGTTTAGAACACAAAGGGTACACGTTGTGGATGGATAACTTCTACAATTCCCCAGCACTTGCCCGAAAACTCAAGTCGATTGGGTTTGATTGTGTCGGTACGTTGCGGACAAACCGCAAGTATGTCCCGACGGAACTGACCAATCTGAAAAAATCTCAGATGAAGCCCGGGCAAGTAGTAGGCTATACCAGTGGAGATGTCGATTGCATAATATGGAGAGATCAGAACCGCGTAGCGACGATCTCAACGTACCATGGCAATGCCGTCTCCACTAAAAACGGAGTAACAAAACTTATTTTGATACGTGACTACAACATCTGCATGGGTGGCGTGGATAAAAAAGATCAAATGTTGGCTGCATTCCCAATTGAACGCAAGAGGACACAAATTTGGTACAAGAAATTGTTTAAAAGTTATTATTAG
Protein
MERFNLIAIEDLPAGEPIEQALTERSKRSWNPRNYEPDGEDIPVILSSPAIPPSPAMYVECGGSGTSTPSSRYNIQISVHGSRSPSPSHKRVRRSLCPDQEHDITNRDSISSLRRPLRDSEICYLLHYGSDDDYSDDESQNDNDEIVPMIIPRAAGILMDTPDDEEIEIDTAAATKPLVTSSSPSIISAPTSPARDTGMKPSHFFEFDWGTFPDSPIPPTERRESFKEHSGPTVAVSDPYEIFRLIWDQEFMEFIVQETNRYAQQLAAEMLDGGELQASSRITEWKETNVDELLVFFGILLAMGIVIKNRVEEYWNTEQNIFSTPGFKVYMSLRRFQLLSRCLHFNNSENLRNLNLDPSQAKLFKVEPVISHLNSKFTELYIMKQNIALDESLLQWKGWLNINQFIPNKAAAVGIKTYEICESQTGYLWRFKIHAHKASPTVSEADPFTASTPALVLNLIKGLEHKGYTLWMDNFYNSPALARKLKSIGFDCVGTLRTNRKYVPTELTNLKKSQMKPGQVVGYTSGDVDCIIWRDQNRVATISTYHGNAVSTKNGVTKLILIRDYNICMGGVDKKDQMLAAFPIERKRTQIWYKKLFKSYY

Summary

Pfam
PF13843   DDE_Tnp_1_7
Interpro
IPR029526   PGBD       

Ontologies

GO

Topology

Length:
601
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0942099999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00229
outside
1  -  601
 
 

Population Genetic Test Statistics

Pi
199.498031
Theta
158.751137
Tajima's D
-0.672364
CLR
0.198515
CSRT
0.206839658017099
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号