SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14631
Pre Gene Modal
BGIBMGA009552
Annotation
PREDICTED:_uncharacterized_protein_LOC106721395_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 2.495
 

Sequence

CDS
ATGTCGGTTGGCCTCCGCGGAGTATCTTCGTCCTCAGAGACCATGTCCGAGAGCACGTTAGAGAGAAACCGAGCTGAAAAGGCTCTGATAACAAAAACTCCAACGCATACGTTACTCAAAAGTAATATTAAAAATTATTCGGACAGGAACGGGAACGATGTCACGGAAACCGTACACAGAGGGAGGAAAACCTTCGCATTTTGGACTCTCGTTTGTCTTTTATTCGTATTGGCTATCGGGAACTTAATTCTGACATTCACGATACTAGCCGTCTTGAGATTGGGACAAGGTCTAGAGAGCATGGAGTTTCTTCCGGAACACAATGCTATAAAGTTCTTTGGTAAAACCAACTTGGAGAATGTATATAAGAGAGACGGTTTGATTGAGAGCTTCAGTGATACACCCATGAGCATAACCAGCGAGAATGGCTCTGTTCTATTCAATCTACAGACTAGACTATCACGATCGGACACGAAACTGCTAATGAATTCGTCCGGGGTCTTCATCCGCGGCGTGAACTCGTTGGAGCTGATCAGCCTCGACTCCGGGGAGGCTGCGTTCAGCACAGCATCCCCCGAGATCAATATACACGAGCCGATCAACAATTTGCAGGCGAAAATGGTGAATAAATATAAAAAAAAAACTAAGCAAGGGACGTGGGATGAAAATGCTATGCAAACGGCTATTAATTTGTGCAAAGCTGGAGAATCAATAAAAAGCACAGCTAAAAAGTATGGTTTGGCTTATGCAACCTTGTATAGGCATGTAAAAACCGGCACCGTTGCTTCAAAGCTTGGTCGATTCCGTCCGGTTTTCACTGAAGATCAGGAAATAGAGTTGGTGACATATCTCAAAGATATGGATTCTGTATTTTTTGGCTTGACTCGAGATGAATTCAAAAATTTAGCGTTCATCTACGCCAAGAAAAATAATTTGAACTACCCGAATAACTGGGACAAGTACGAAAAAGCTGGAGATGATTGGCTATCGTCATTTTTGTCTCGTCACAATCAAATATCCCTCAGGACTCCAGAGGCAACATCGGTTGCAAGGGCAAAAGGATTTAATAGACATGAAGTTGGCCGTTTTTATGAAAACCTTGAAGCTTTAACAGTAAAATATGATATTGATGCATCTAGATTATACAACATGGATGAAACTGGTATATCTACAACCACAAATAAGCCGCCTAAAGTGCTATCAACGAAAGGAAAGAAACAAGTGGGCATCATCGCCAGTGCAGAACGTGGTCAATTAACTACTGTCATAGGTTGTTGTAATGCCGCTGGTTCATTCCTCCCACCATTCTTAATTTTCGCCAGAAAAAAGATGCAACCCAGACTACTTGATGGTGCGCCTCCCGGCACTCAAGGAACCTGTACTCCAAATGGTTGGACTTCAGGTGAGGTATTCCTTGATTGGATGCATTTTTTTGTGGAACATGTTCGACCTACCCCTGAGAAAAAAATACTTCTATTATTGGATAACCACGAGAGCCATAAGTATTACCCAGCTTTAGATTACGCCAGCAAGAACAATGTCGTAATTTTATCCTTGGCCCCACACACAACTCATAAAATGCAGCCCATGGATGTAGCGGTATACGGCCCACTAAAAACTTACTTTGAAAGGGAGATAAATTTCTTCCAAAAATCGCACCCAGGACGCATTATAAATCAATACGATGTAGCCAGACTGCTATCACCAGCTTTTCTGAAAAGTGCAGTAGCTCAAAATGCAGTTCATGGATTTGAAAGACCTGGTATTTGGCCAGTGAACAAATATGCTTTTGGTGACGAAGATTATGAGCCAGCCGCTGTTTTTGCAGGCATGTCTAATATGAATATTGGCACAAAAAGTACAAACTCACTAGAAACGATAGATATTCCCAGACCTTCTGTAGACACTTCTTCAACTCCTTCGCCTTCGCTTCTTCAAGAACAGATTCCATCAAGTTCAGTAGATCCTCTATCAGAAATATTTCCATCTCGAAACAGAACTTCCTCTTGTGAGTTTCAAGACTTTGTTGCGCCCATTGTTAACACGCGTGAAAAGTTTCGTAGCGACGGGTGTACACCTGAACCAGAACCTGGATGTTCCCGAATTGTTTCCGCTTTAGAGCCAGATATAGCTGCTCAGAGAGGTGACACAGTGGTGCCAGATATTGAAGTAAATACTCGGCAAAATACTAGCTGTGACAACACATCTGATCCTAAACCGGAATGCTCAGCCTCCCATTGCAGTCCCTTGGTGTTAAGACCTATTCCAAATCCTGCCAAACCAATGACCACGCGAAAACGGAAATTACAAAAATCGGAAATATTAACCAGTACCCCGATCAAAGAAGATCAAAAGCATAAATATGAGAAAAATAAAGTTAAGAATATTAATAAAAGACTGAATGATAAGTCAAAAAATGTTCCTAAGAAGATTAATACAAAGACTGACAAAGACAAAAAAACTACTAAAAAGGTTAAACAGCCAAAGAAAATAAAAGAATTTAAGGATATTTTATGCTTTTTTTGCGGTGAAATATATATAGAAGAAGACGGTAAACCAATTGAAAATTGGATTCAATGTGACATTTGTCAACAATGGTGTCACGAAGATTGTTCTGCTTTTGATGGCGCTCTAGGTTATACCTGTGACAATTGCCAATCTTAA
Protein
MSVGLRGVSSSSETMSESTLERNRAEKALITKTPTHTLLKSNIKNYSDRNGNDVTETVHRGRKTFAFWTLVCLLFVLAIGNLILTFTILAVLRLGQGLESMEFLPEHNAIKFFGKTNLENVYKRDGLIESFSDTPMSITSENGSVLFNLQTRLSRSDTKLLMNSSGVFIRGVNSLELISLDSGEAAFSTASPEINIHEPINNLQAKMVNKYKKKTKQGTWDENAMQTAINLCKAGESIKSTAKKYGLAYATLYRHVKTGTVASKLGRFRPVFTEDQEIELVTYLKDMDSVFFGLTRDEFKNLAFIYAKKNNLNYPNNWDKYEKAGDDWLSSFLSRHNQISLRTPEATSVARAKGFNRHEVGRFYENLEALTVKYDIDASRLYNMDETGISTTTNKPPKVLSTKGKKQVGIIASAERGQLTTVIGCCNAAGSFLPPFLIFARKKMQPRLLDGAPPGTQGTCTPNGWTSGEVFLDWMHFFVEHVRPTPEKKILLLLDNHESHKYYPALDYASKNNVVILSLAPHTTHKMQPMDVAVYGPLKTYFEREINFFQKSHPGRIINQYDVARLLSPAFLKSAVAQNAVHGFERPGIWPVNKYAFGDEDYEPAAVFAGMSNMNIGTKSTNSLETIDIPRPSVDTSSTPSPSLLQEQIPSSSVDPLSEIFPSRNRTSSCEFQDFVAPIVNTREKFRSDGCTPEPEPGCSRIVSALEPDIAAQRGDTVVPDIEVNTRQNTSCDNTSDPKPECSASHCSPLVLRPIPNPAKPMTTRKRKLQKSEILTSTPIKEDQKHKYEKNKVKNINKRLNDKSKNVPKKINTKTDKDKKTTKKVKQPKKIKEFKDILCFFCGEIYIEEDGKPIENWIQCDICQQWCHEDCSAFDGALGYTCDNCQS

Summary

Pfam
PF03184   DDE_1        + More
PF05225   HTH_psq
PF03221   HTH_Tnp_Tc5
Interpro
IPR013083   Znf_RING/FYVE/PHD        + More
IPR036880   Kunitz_BPTI_sf       
IPR009057   Homeobox-like_sf       
IPR011011   Znf_FYVE_PHD       
IPR004875   DDE_SF_endonuclease_dom       
IPR007889   HTH_Psq       
IPR001965   Znf_PHD       
IPR006600   HTH_CenpB_DNA-bd_dom       
IPR019787   Znf_PHD-finger       
IPR003599   Ig_sub       
IPR036179   Ig-like_dom_sf       
IPR019786   Zinc_finger_PHD-type_CS       
IPR007110   Ig-like_dom       
SUPFAM
SSF46689   SSF46689        + More
SSF57362   SSF57362       
SSF57903   SSF57903       
SSF48726   SSF48726       
Gene 3D

Ontologies

Topology

Subcellular location
Nucleus  
Length:
887
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
23.31769
Exp number, first 60 AAs:
2e-05
Total prob of N-in:
0.99876
inside
1  -  69
TMhelix
70  -  92
outside
93  -  887
 
 

Population Genetic Test Statistics

Pi
164.511912
Theta
175.517227
Tajima's D
0.442778
CLR
0.611643
CSRT
0.500124993750312
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号