SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14620
Annotation
PREDICTED:_uncharacterized_protein_LOC106141967?_partial_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 4.654
 

Sequence

CDS
ATGGAAAGAGAGTATGAAGATGAAATAGACAACCCTGAATTAACAGAAACAGAAGGAACCATTAATAATGACAGCAGCTTTCAACGGGCTATTATTGACATCATACCTGAAAAAAATATGGATGTAATGAGGAAATCTTTAGAAGATGATAATGAAAATGAACAAATAATTCAAAAAGCGGATGATCATACAATATGGAAGAAAAACAAACAGGCTGGATTTAAAAGAAGCCACATTGATTTCTTAAGGGAAAATGAAGGTTTTGTCCGGGAATCAACATCATGTAAAGAAACAGATGATCGGTCTTCAAATGATAAAGATGATCAAGCACCAAAGAAGAGAAAAAAAACAAGCCCAAAAGATGGAAAAGTAGATAATGCAGGATTAAAAAAGAAAAGAATAAATAAGAAAAAGATAAGAAAGGATGCTAGATCAAAGGGCATTCAATATATTAAGGCAAATGGTACAATCGCGAAAGAAAGAACCATGAAACCGAATCCTTGCTTGGAAAAGAACTGTCCCTACAAATGTCAAGAGATAACCACGGAAAGAAGGAGTGCCATATTTAAACATTTCTGGGAATTGTCTATGGAAAGAAAAAAGCAATGGATAATCTCTATGACCACTAAGCAATCCATAAAAAGGAAAAGATCCAAAAACTCAAATTACAGGAATAATACGTTCTTTTATTTTATAAATGATGGAGAAAGTCGGCGTCAAGTCTGTTTGAAATTCCTCATGAATACACTTGATGTCACCCAAAGGTACATTTATTATACATTGACGAAATAG
Protein
MEREYEDEIDNPELTETEGTINNDSSFQRAIIDIIPEKNMDVMRKSLEDDNENEQIIQKADDHTIWKKNKQAGFKRSHIDFLRENEGFVRESTSCKETDDRSSNDKDDQAPKKRKKTSPKDGKVDNAGLKKKRINKKKIRKDARSKGIQYIKANGTIAKERTMKPNPCLEKNCPYKCQEITTERRSAIFKHFWELSMERKKQWIISMTTKQSIKRKRSKNSNYRNNTFFYFINDGESRRQVCLKFLMNTLDVTQRYIYYTLTK

Summary

ProteinModelPortal

Ontologies

GO

Topology

Length:
263
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00232
Exp number, first 60 AAs:
0
Total prob of N-in:
0.08842
outside
1  -  263
 
 

Population Genetic Test Statistics

Pi
131.776581
Theta
168.860308
Tajima's D
-0.996267
CLR
177.228591
CSRT
0.139493025348733
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号