SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14616  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA008776
Annotation
PREDICTED:_metal_transporter_CNNM4-like_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.082 Nuclear   Reliability : 1.331 PlasmaMembrane   Reliability : 1.238
 

Sequence

CDS
ATGGTAGGGCGGAACAACCCCTTTGGCGGCCAGTGGGTGCATCAAGGCTCCGAATATTATTTGCAGCCGAAAAACGATTCTCTTTCAGAGGAGAATAATCGATCGCAAAAGCCGAGGTCTCTCAACGAACTCCAGGAAAACGAAGATAACTGGATCGACCTCTCCCACGACATCGACGTGAATTATCTTCCCAGAGCCAGACCTGCTCGTAATGATAATCCAGATGTAGAAATATTTAGACACGATGATTATATAGCTCTGGATGGAACCGATAAAGTTTGGGATGAAAAGAATAATTTGGGACGGTTTAAAAGAGCTGATGGGATTGCGGCTAAAGCTGCGGAGAGAAGCTCGACAGATTTAGACAATGTCGTGTTAAACAAAAACGCTTCTAATGATGATGGCAGTAAAGATGACACTCGAACAAGAGCTCAAGGATCTGCGAGTGAATTGTTCTCAGAGGAATTGATAAGAAAATCTCGTCAAATAGTAGATTCGAATGATTTTACGAGTATGCGAGCGGCCCCTATCGATATTTTCATCGAAGGAATCAGGATCGAAGAGTCCGAGAAAGAACCACATATTGAAGACGGAATACCGAGTGTGCTGGCCGATACTGCAGTTACGATCAGGGTATTCGGCGATGGGTTAACTTCGAAAACTGCCATCGCTTTCACACGACAGGACCTGCCGTACGGCCAACCCTGCAAGTTTCTACTCATGGGAGAGTATATGGTAAAAGAAGGCAGCGTCACCACCAGATCCGCGTTGTTCGATGTAACAGCACCCCCCTCACAGGAGGGCTCTAAGATCTACATCTGCGCTAAGAATCTCCAGGCAGGGGCTGATCACCCGACCAAGGACAAGGAAAATTACTATCACCAGGGAACTGAATCCTGGAAGGCGTTTGCTACCCACAACACCCTGCTGCCGCTCTGGGTGTCGCTGAGTTTGATTCTGATATGCCTGACATTCTCTGCGCTTTTCTCTGGGTTGAATCTCGGTCTGATGTCATTGGACAGGACCGAACTGAAGATCATAGCCAATACCGGTACGGAAACGGAGAGGAAATACGCCAGAGCCATCATGCCCGTCCGGGATCATGGAAATTACTTGCTGTGCAGCATATTGTTGGGGAATGTGGCTGTGAATTCGACTTTCACGATTTTGTTGGATGAACTGACTTCGGGCCTCTTTGCTGTTATATTCTCGACCCTGGCTATCGTACTCCTGGGCGAGATAACTCCCCAAGCCATATGTTCGAGACACGGTCTTATGATTGGTGCCAAGAGTATCATGATTACGAAGGCGGTTATGGCCCTGACGGCGCCGATGGCGTATCCTGTGAGTAAACTCCTGGACTATTTCTTAGGCGAGGAGATAGGCAGCGTTTACAACAGGGAACGTCTAAAGGAGCTTATCAAGGTGACAACTGGGGACTTGGACAAGGACGAGGTGAACATCATATCCGGCGCCCTCGAGATGAGGAAGAAGACCGTGTCAGACGTCATGACGAAGATGGAGGACGTGTTCATGTTGCCGATAACAAGCGTCCTGGACTTCGAGACGATGTCGGAAATTGTAAAGTCGGGCTACTCCCGCATCCCGGTGTACGAGGGTCACCGCGGGAACATCGTGACGGTGCTCTTCATCAAGGACCTCGCCTTCGTCGATCCCGACGACAACACGCCCCTTAGGACCCTCTGCCAGTACTACCAGAACCCTTGCAACTTCGTCTTCGAAGACGTCACCTTGGATGTCATGTTCAAACAGTTCAAAGAAGGTCACAAAGGACACATGGCGTTCGTCCATCGCATAAACAACGAGGGCGAGGGAGACCCCTTCTACGAGACCATAGGGCTGGTGACCCTGGAAGATGTCATCGAAGAGATGATACAAGCAGAAATCGTCGATGAGACTGATGTGTTCATGGACAACCGCAGCAAGCGACGCAGGAACCGCCCCTCGCACAAGCTCCAGGACTTCGCCGCGTTCGCGGAGAGGCACGAGAACCAGAGGATCCACATCTCGCCCCAGCTCACCCTGGCCACGTTCCAGTTCCTGAGCACGAGCGTAGACGCGTTCCGTCCGGACGTAGTGTCGGAGACGGTTCTGAGACGTCTCCTGAGGCAAGACGTCATCCAGCACATCAAGCTTAAGGGGAAGACCAGACGGGATTCGGCCACATACGTTTACCATCAGGGGAAACCGGTCGATTACTTCGTTTTAATCTTAGAAGGACGAGTCGAAGTTACCGTAGGACGGGAGAACTTGATCTTTGAAGCTGGACCCTTCACATACTTCGGTGTACAAGCCCTTACACAGAACGTTGGAGTTGCCGAGTCTCCTACACCATCAGCGATGGGTTCCCTACAGAACATCAATATGGACTCGATGTTGCGACACACTTTTGTACCGGACTATTCGGTTCGCGCTATCTCTTCCGAACTTTTCTATCTCACTGTGAAGCGCGCTCTGTACCTGGCTGCGAAAAGGGCGACCCTAATGGAGAAGGGCGCCCTCTCCAAGGGCACGACCAACGAACAATTCGACACTGAAGTCGACAAGTTACTCCAGTCTGTAGACGAGGACATCAGCGTGAGCGGGGAGCACAGGACTCCATCGAGACAGGTATCGCCCAATCCTCCACCAGTGTCGGCTTCGCCCCACGTTCGGGCAACTTTCGCGTCGCCCGACAACAATGGCGACGTTTACACGACCCACAACCTGAAGGCCGACGAGGAGGAGAAACTTCTGAAGTGA
Protein
MVGRNNPFGGQWVHQGSEYYLQPKNDSLSEENNRSQKPRSLNELQENEDNWIDLSHDIDVNYLPRARPARNDNPDVEIFRHDDYIALDGTDKVWDEKNNLGRFKRADGIAAKAAERSSTDLDNVVLNKNASNDDGSKDDTRTRAQGSASELFSEELIRKSRQIVDSNDFTSMRAAPIDIFIEGIRIEESEKEPHIEDGIPSVLADTAVTIRVFGDGLTSKTAIAFTRQDLPYGQPCKFLLMGEYMVKEGSVTTRSALFDVTAPPSQEGSKIYICAKNLQAGADHPTKDKENYYHQGTESWKAFATHNTLLPLWVSLSLILICLTFSALFSGLNLGLMSLDRTELKIIANTGTETERKYARAIMPVRDHGNYLLCSILLGNVAVNSTFTILLDELTSGLFAVIFSTLAIVLLGEITPQAICSRHGLMIGAKSIMITKAVMALTAPMAYPVSKLLDYFLGEEIGSVYNRERLKELIKVTTGDLDKDEVNIISGALEMRKKTVSDVMTKMEDVFMLPITSVLDFETMSEIVKSGYSRIPVYEGHRGNIVTVLFIKDLAFVDPDDNTPLRTLCQYYQNPCNFVFEDVTLDVMFKQFKEGHKGHMAFVHRINNEGEGDPFYETIGLVTLEDVIEEMIQAEIVDETDVFMDNRSKRRRNRPSHKLQDFAAFAERHENQRIHISPQLTLATFQFLSTSVDAFRPDVVSETVLRRLLRQDVIQHIKLKGKTRRDSATYVYHQGKPVDYFVLILEGRVEVTVGRENLIFEAGPFTYFGVQALTQNVGVAESPTPSAMGSLQNINMDSMLRHTFVPDYSVRAISSELFYLTVKRALYLAAKRATLMEKGALSKGTTNEQFDTEVDKLLQSVDEDISVSGEHRTPSRQVSPNPPPVSASPHVRATFASPDNNGDVYTTHNLKADEEEKLLK

Summary

EMBL
NWSH01000060    PCG80066.1    KQ459249    KPJ02289.1    AGBW02009783    OWR49924.1    + More
RSAL01000199    RVE44514.1    BABH01040476    BABH01040477    NWSH01000720    PCG74629.1    ODYU01003035    SOQ41307.1    KQ435710    KOX79812.1    KQ414940    KOC59188.1    KZ288287    PBC29416.1    KQ777939    OAD52039.1    KQ434892    KZC10512.1    GFDF01009584    JAV04500.1    JXUM01089765    KQ563796    KXJ73288.1    CH478182    EAT33657.1    KQ978231    KYM96089.1    NEVH01001355    PNF42861.1    GAPW01000183    JAC13415.1    GL447495    EFN86431.1    KQ981940    KYN32677.1    QOIP01000001    RLU26364.1    GL768163    EFZ11891.1    KQ980079    KYN17809.1    KK107159    EZA56684.1    KQ982850    KYQ49943.1    GL888334    EGI62522.1    KQ976529    KYM81791.1    ADTU01027491    ADTU01027492    GFDL01001745    JAV33300.1    KQ971312    EEZ98477.1    GFDL01001739    JAV33306.1    GL439921    EFN66596.1    KK853149    KDR10673.1    KA647782    AFP62411.1    GECZ01000402    JAS69367.1    GECZ01013304    JAS56465.1    GEZM01102946    JAV51687.1    OUUW01000010    SPP85574.1    GECZ01020191    JAS49578.1    GECZ01023653    JAS46116.1    CH940649    KRF81674.1    NNAY01000444    OXU28342.1    GFXV01004124    MBW15929.1    JRES01001511    KNC22356.1    CH902628    KPU75331.1    GAMC01017159    JAB89396.1    GGMR01008607    MBY21226.1    GEZM01102944    JAV51689.1    ABLF02030588    ABLF02030600    ABLF02030602    ABLF02030604    GEZM01102945    JAV51688.1    KB631924    ERL87181.1    CH954177    KQS71083.1    AE013599    AIG63332.1    EDP28148.2    EDP28149.2    ELP57407.1    APGK01044408    APGK01044409    APGK01044410    APGK01044411    KB741026    ENN74893.1    CP012523    ALC39157.1    GAKP01008896    JAC50056.1    GDHF01005181    JAI47133.1    CH891640    KRK05076.1    KRK05075.1    KRK05077.1    CH933807    KRG03803.1    CVRI01000048    CRK98833.1    GBXI01010406    JAD03886.1    GEDC01009880    JAS27418.1    GGFJ01001300    MBW50441.1    GGFJ01001304    MBW50445.1    ADMH02001227    ETN63585.1    GGFM01002384    MBW23135.1    GGFJ01001207    MBW50348.1    GGFM01006966    MBW27717.1    GGFK01004617    MBW37938.1    AJWK01034728    AJWK01034729    AJWK01034730    AJWK01034731    GGFK01004694    MBW38015.1    GGFK01004914    MBW38235.1    GEDC01009151    JAS28147.1    ACPB03006135    GEBQ01025213    JAT14764.1    GGFM01002893    MBW23644.1    DS235845    EEB18394.1    KK857470    PTY27200.1    CH916368    EDW02787.1    GDHC01022009    JAP96619.1    ATLV01026534    KE525415    KFB53162.1    GBHO01039189    JAG04415.1    GDHC01009380    JAQ09249.1   
Pfam
PF01595   DUF21        + More
PF00400   WD40
PF08799   PRP4
PF00571   CBS
Interpro
IPR000595   cNMP-bd_dom        + More
IPR014710   RmlC-like_jellyroll       
IPR000644   CBS_dom       
IPR018490   cNMP-bd-like       
IPR002550   CNNM       
IPR001680   WD40_repeat       
IPR014906   PRP4-like       
IPR017986   WD40_repeat_dom       
IPR015943   WD40/YVTN_repeat-like_dom_sf       
IPR036322   WD40_repeat_dom_sf       
IPR019775   WD40_repeat_CS       
IPR036285   PRP4-like_sf       
IPR020472   G-protein_beta_WD-40_rep       
SUPFAM
SSF51206   SSF51206        + More
SSF50978   SSF50978       
SSF158230   SSF158230       
Gene 3D
PDB
4IY0     E-value=5.27717e-55,     Score=546

Ontologies

Topology

Length:
920
Number of predicted TMHs:
4
Exp number of AAs in TMHs:
86.4901500000002
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00899
outside
1  -  309
TMhelix
310  -  332
inside
333  -  368
TMhelix
369  -  391
outside
392  -  394
TMhelix
395  -  412
inside
413  -  424
TMhelix
425  -  447
outside
448  -  920
 
 

Population Genetic Test Statistics

Pi
258.061895
Theta
188.580252
Tajima's D
1.373313
CLR
0.247002
CSRT
0.75921203939803
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 VEVTVGR 100.00 0.006
28556443 VTGWDAPFPHVFEPF 100.00 0.006
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号