SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14611
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.827
 

Sequence

CDS
ATGGATTTCGAATCCGCGTCAAGCCCTCAGCCTGGAACTTCGGATGGGTTCCAAACCGTAACGCGCGGCAAAAAGCGTACTCGCGCCGTGGAGTCCCGGAGCTCCACGACGAAACAGACTAAATCCGCGACCGCCTCCCACCCGCAGGTAGTCGTGACACCGGAGTCGGACTCCGCTCGCCGCGTAACCCCGCCGCCGCGTCCCAAGCCCGCGCCCGCTCCTAAAGTAGCTGCCCCGCCCCCGCTGATACTTCAAGAGAAGACAGCGTGGAATCGCGTGTCCCTGGCCCTTCAGGCCAACAAAATTAATTACACCCATGCGCGTAACGTCGCGCATGGGATTCAGATAAAGGTCGCAACGCCGGGCGACCATAGGGCCCTCTCAGCATACCTCCGAAAGGAGAACATAGGTTTTCACACCTATGCTCTTCAGGAGGACCGCGAGCTCCGCGTAGTAATACGCGGAGTCCCTAAGGAGCTAGAAATAGACTACATTAAGGAGGATCTGACCGCTCAGGCCCTCCCGATAGTTAGTGTGCACCGGATGCACAGCGGGCGGGGCAAACAGCCCTATAATATGATACTCGTGGCGTTAGAACCCACCCCGGAGGCCAAAAAGAAGATCGCATGTCTCACGACAATTTGCGGCCTATCCGGGATCTCGATCGAAGCCCCCCACAAGCGTGGCACTCCCGGGCAGTGCTACAGGTGCCAACTCTATGGCCACTCGGCGCGTAATTGCCACGCGCGCCCCCGCTGCGTGAAATGCCTCGGCGATCACGCTACGTTAGATTGCGTTAGAGATAGGGAAACCGCGACCGAACCTCCCAGCTGTGTCCTATGCCTTAAGCAAGGGCACCCCGCGAACTACCGTGGATGTCCCACGGCTCCGCGAAAACACCCAACTCCGCGAACCGTCGGCCCAAAGACTTCGGCACCTTCAGTGCCGAAACCCGCCTTCGTGCCGGCTGCAGTTCCCACGGTCTCGGCGTGGAAAAAGCCGCTGCCGTATACGAAGGCGGGAACGGAAACCGCACCCCCGCCCCCGCTCGTGACACGCCCCGCGCCCCAGCCCCTGCTCGCACCTCGCCCCGCGCCCGCGTTCCGTCCCCCGCAACCCTCTGCCGTCAACGACTTCGCGCTCGTGCGCGACTTCGTCACCGCGGTCAACTTCGACCGTCTGCGATCGTTCGCAGACGCGATACGAAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTATAGGCGGGCCCTGCACGTTGTCCCTCTCGATACTCCCTCGCTCTCACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTCCTGAGCAGTGACATCGAGTCACTGTTCGGCATGGGAGACTCTGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGTACAAACGTTAACGGTAGGCGTCTCGACGCGTTTATAGACGACCTCACCTTTGAAATAGTCGGTCCCCCAACTCCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCATTGCTTAGGAACGTAACTCTGCGCTTGCGTTCCATCGAAGCAATGTCAGAGCTCGACTCAGACCACCGACCTGTCGTTATGCAGCTCGGTCGCCCTCACAACCCAGTCACTGTTACGAAGACCATGGTGGATTGGAATAAGCTGGGCACGTGCCTAGCCGACGCCGCTCCGCCAATCCTCCCTTACGGCCCGGATTCGAATCCATCCCCCGAGGACACCGTCGAATCCATAAACATCATTACCGATCACATCTCTTCCGCGATCATTAGATCTTCTAAAGAAGTCGATGTGGAGGACAGCTTCCACCGCATCAGACTGTCCCCCGATCTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTTCCCACGCATTCAAACCGGATTCAGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCTTAAGCGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCTTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACAGGCGGACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACGGACGAAGTTAGAGACGCGATCCTCAACCTCCAACCTAGGAAGGCACCAGGCTCCGACGGCATCCACAACCGCGCGCTAAAATTTTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCAGTGTGGAAAGAAGCGGACGTTATCGGTATACATAAGCCGGGCAAACCGACAAACGAAACCTCTAGTTACCGTCCGATTAGTCTCCTCTCGACGATAGGAAAAATCTACGAACGGCTCCTTAGGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCTAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATTCTGATAGGACTTAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTATAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACCGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCATGGGACAGTGGTTCCGGAAGTGGCGAATAGACATCAACCCCACGAAAAGCGCAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACATCACTTCGAGCATCCCACTCCGTAGTAGGCGCGCAAACACCTCCGCCGTTAGTCCCATCACTCTCTTTGGCCAGCCCATACCGTGGGTCTCGAAGGTCAAATATCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCATATAAAAACGGTACGCGACCGCGCCGCGTTTATTCTAGGACGACTCTATCCAAAGCTTTGTAGTCGAAGCAAACTGTCCCTCCATAATAAGGTAACTCTCTACAAAACTTGTATACGCCCCGTCATGACGTATGCAAGCGTAGTGTTCACTCACGCAGCCCGCACCAACTTGAAATCCCTTCAGGTTATTCAATCACGATTCTGCAGGATAGCCGTCGGAGCGCCTTGGTTCCTTAGGAATGTGGATCTCCACGACGACTTGGAGCTCGACTCTTTTAGTAAGTATCTACAGTCGGCATCGCTGCGCCATTTTGAGAAGGCGGCACGACATGAGAACCCTCTCATCGTAGCCGCTGGAAATTACATACCCGACCCAGTAGACCGAATGATTGAAGAAATGGTGCTCACACGGTCCGAGAAGATGAGGTCGTCACGCCTTGACCGGCCCGGCAACGAAGCTGTCTCGGGCTCAACATCACAAGACGCACAGCAACGAGCTGTGTCGGCCGCGCCGCGTTCGGGAGTGACGGAGGGACCGCCACCGATGGCGGCAACCTCCTCCCAGTCAACCGCGCCGCGTTCGGGAGTGACGCAGGGACCGCCACCGATGGCGGCACCCTCCTCCCAAGTGGAAAAGTGTCCGGGAGTGCCGCGGGGCTCACAAGCGATGCCCCCCTCCCGCCAAATATTGCCTACGCAATACTCGCCGGCGTCGCCAACGGGACCGAACAGCGGGGTCTGTCGTCGAGTGGTCAGACCTCCCAGCACCGCGACACCGGCAACAACTTCAGGCGACGCAGCAACGGAGAGCGTCGTATCCGCGAGCCAGAACAGAAAGGAGTCAGCGCTCACGGCCAATCAAATTGTACACGGGTCCCACATCACGGACGCCGCTGCCAAAATCTCGACGACAGAAGAAGGCTCCACACTCCGCGACGGGATGGCGCCACCAGTACGAGGATCTTCAAGAAAGTCGAGTCAACAGTCACAACGGCTGTTGCTTATGGCGCGCCTCAAAGAAGAGCATCTTCGCGCCAAGGAAGAACAAGCCCGACTCCGAGCAGAGCTCGCCGCCGCCCGCATCTCAACATTAGAAGCCGAAGCGCTCGTTGAAGAGGAGGAAGATGCGCGCACAACACTCACGGAGGACGAGAACGAGCAATCGCAGCGCATCGATACATGGCTCAGTCAGCAACGATCGATCGCGCTACACGGAGTCGAAGAAAGAGTAATGCAGCCAACACACGGATCACCAGCCACCATCGAGCAACCGCAACTGGAACTTCCCGCACCAATAGAACAGCTGAAGCTACCGGCCCCTGCCGCGGCACCGATTGCCGCACCTGTCGCACCGAAGAGCGACATTGCCGAACTAGCAGCTGCCATCGCGACGGCCGCCCGCCAAGCCAGGCCCGGACCATCGCATCGGTACTACGGGGAGCTTCCAGTGTACAGTGGATCGCATCAAGAATGGCTCTCCTTCAAGGTCGCCTACGCCGAATCAGCGGACAGCTTCAGCGCCGCAGAGAACACTGCGAGACTTCGGCGTACGTTAAGAGGAAGAGCAAGAGAAGCGGTCGAAAACTTGTTGCTGCACTACACCGAGCCCGCCGAGATCATGCGGACTCTAGAATCGCGCTTCGGACGTCCAGAAGCAATCGCCGCAACGGAGCTGGAACGACTGCGCGCGCTGCCACGCTGCACGGACACACCGAGGGACATCTGCGTATTTGCAAATAAGGTGAACAACGTCGTCGCCGCTCTGAGGGCCCTCGACCGCGTACATTACATGTACAACCCGGAGCTCACCAACATCACATCAGAGAAGCTGCCGTCCACTCTACGCCACCGCTGGTTCGAATTCTCAGCGACTCAACCGGCGGGAGAACCGGACCTCGTCAAGCTGTCGCGCTTCTTACAGCGCGAGGCGGACCTGTGCAGCCCATACGCACAGCCGGAACCAGAGACGAGAGTGGAGAACACCAGCGGTCGGCGGAAGATGGTGAACACGCCTCAGAGGACGCACACCACGCAAGCGAAGGAAGAGAGGAAATGCGCAGCATGTCAGAAGCCGGGGCACATCCCACAAGATTGTCCCGAATTCAAGAGAGCAGCCGTCAGCGAGCGCTGGGATACGGCGAAGCGCGAAAATTTGTGTTTCCGGTGCCTACGGTTCCGGTCCCGGGGACACGTATGCAAAAAGAAGAAGTGCGGCGTCGACAGCTGTGAACGCACGCACCACGAGCTGTTGCATAAGAAACCAGCATGGCAGAAGCCGAAGGAAAAAGAAGAGGCGGTCACCTCGACGTGGGCCGCAAGAAGTGCGACAGCCTACCTGAAGATGGCGCCAATTACTGTTATCGGACCGGCGGGAGAAGCAGATACATGGGCCCTGCTGGACGACGGGTCAACGATCTCGCTGATCGACGAAGACTTCGCGAGACGAGTCGGCGCCAAAGGACCGATTGAACCCCTCTTCATCACTGCCATCGGAGACAACAAGATAGACGCAACACGCTCACGACGCGTCCCGCTGAAGCTATGCGGACGCACGGGGGAACCGCAAGAACTGAACCTACGGACAGTCAACGGCTTAAAATTAACACCACAGCGACTGAACATCGAAGTCCTCGCGTCGTGCCATCACCTCACCGACCTAAGCCATCACTTCAAAACGAGCTACGCCTCGCCGAAGATACTGATCGGCCAAGACAACTGGCACCTGCTGGTGACGGAGGAGATGCGGACGGGACGACGCGATCAACCAGTGGCGTCTCGTACTCCGCTCGGGCACTACTTCGCGATCGAGGGACTCACCGTCGCCGCCAAGACACCGAAGAATGACCCAGACGAGCGCGCACTGAAGATCCTGCGAGAGACCACTCAACAGCGACCCGACGGCCGCTACGAGACCGCACTGCTGTGGCGTGAGGAGAGCCTGAAGATGCCCAACAATTTGGAAGCCGCACTAAATCGCCTGACGTCCGTAGAAAAGAAACTGGAGAAGGATCCAAATTTGAAAGAGCGCTACAAGCAACAAATGGACGCACTGGTAGCGAAAGGATACGCCGAAGTAACTCCTTCGACGGGTACGAAGAAGCGAACCCGGTACTTGCCACACTTCGACGTAACACATCCAATGAAGCAGGAGAAGCCTCGCATCGTGCACGACGCCGACGCGAAAAATAGAGGGAAGAAGCCCAAACGACTTCCTGCTCACCGACCCGGACCTGCTGCAGTCGTTGCCCGGAGCGATGATGCGCTTCAGGCAGCACGCCGTCGCCGTCTCCGCGGACATCACGGAGATGTTTATACAGATAGGCGTCCGAAGCGAGGACCGCGACGCGCTCCGGTACTTGTGGAGGGAGGACCCTTCACAAGAGCCCATAGAATACCGGATGAGTACCCGGACGCTGCCGACCTCAAGCTCCACACATACGTGGACACCAACAAGTACGCCCACGACGCCGCGTTGTACTGGCGCGTGGAGACGCCCGACGGGGAGACGAGGACCTCCCTCGCCAAAGCCCGAGTCGCACCCATGAAGCCAACATCGACACCGCGCCTCGAGCTACAAGCCGACGTGATGGGAAGCCGCATAGCCGCGGCCGTCACGGGAAAACATTATAGAAAACCAGACACGAGTGTTCTGGACCGACAGCGCCACCATAGAAGAGAACAGCACTGTGGAGGAATGGCGCTGGAAGAGACGGGCGAAGAGAAGTGCGCAACGCTCGCCGTGAGCAGAGAGAGCCTCGGTGAAGCGATCCCGGACCCAAGACGCTTTTCAAAATGGGAAAAGTACCTGCGTGCAACGGGGCGAATACTGCAATTCGTCAGCCTATGCCGCAGGAGTCGCGAGCGCACTCATTACAAGAGGACCAGACGGAACCCGCGCTCGGACCCGACGTGGGAGAAAAACAGAAAGAAGACGACTTCGAAGACCCCGCTGAACACACCGCGGACGCCAGAGCAAGCAGTCATTCAATGGAAGACTTTAGACGCCGACACGCTTCGACGCGCCGAGACGCTCATTTGGCAACAGAGCCAGCGGGCGGCCTTCGAGGAAGAGATTTTGACGCTCCAGCGAGGGAAACAAATATCCCCAGCGAGCCGACTGCGAAACTTGTCCGTAACTTACGCGGACGGGATATTGAAAATAAACGGACGCATCGGCAACATAGAGGGAGCTGACGTCATCACCTCGCCTCTCGTGCTAGACGGATCCCGACGCGAAACGAGACTGATGATAGACTTCATCCATAGAAAGATGCACCACGCCGGAACCGAAGCTACGATCGCCGAGTGCCGACAGTCGACACTCCACCGCGTCCAGCCACAGGCGACCACCCACCGAGCAGACTGGCACACCATCGGCGACCATTCACATACGTGGGCCTCGATTACTTCGGGCCCTATCAAGTCACCACCGGCAGAAGCACCCAGAAGCACTACGTGGCCATCTTCACATGTCTCACGTGCGGTACATTTAGAACCGGCAGCGAGCCTCAGCACGGACTCAGCGGTGATGGCACTCCGGCGCATGATCGCGCGCCGGGGAGCCCCGACGGAGATATGGAGCGACAACGGCACCAATTTACGGGGTGCCGACAAGGAGCTGCGCCAAGCTTTGGACAAGGCGACCGAGCATGAAGCAAGCTTAAGGCTTACACAATGGCGCTTCATCCCACTGGGCGCGCCTTTCATGGGCGGCGCCTGGGAGAGAATGGTGCGGGCGGTAAAGGCCGCGCTCTCGGCCACGGAGCAGCCGAGGCACCCGACGCCCGAAATATTTCACACTCTGCTAGCTGAAGCAGAATTCACCGTGAACAGCCGACCTTTCACTCACGTATCGGTGAGCGCCGACGATCCCGACCCTCTGACACCGAACCACTTCCTGCTGGGAGGCCCGGCGCGAGTCCCCGTGCCGGGCAAGTTTGACGACGCCGACCTCATAGGGCGCGCACACTGGCGCGCAGCTCAACGTCTGGCAGATGTGTTCTGGAGTCGCTGGCTCCGGGAGTACCTGCCCGACCTGCAGAACCGGCGGGAGCCCCACAGCCGCGGGCCCGCCCTGAAGATAGGCGACGTCGTGATAATAGCAGACGGAACGCTCCCACGGAACACCTGGCCACGAGGGATCATCCAGGAGGTTTACCCGGGGGCCGACGGCATCACACGAGTGGTCGACGTGCGCACCGCCGGCGGTATCCTGCGACGCCCGGCAAAGAAGATCATCGTGCTGCCCACGATGTCCGCCGCTCACCAAGGAGGATGCAGCGACGTGAACGACGCTGCACGGCGGGAGGATGTTCGCGACGGACATAAATAA
Protein
MDFESASSPQPGTSDGFQTVTRGKKRTRAVESRSSTTKQTKSATASHPQVVVTPESDSARRVTPPPRPKPAPAPKVAAPPPLILQEKTAWNRVSLALQANKINYTHARNVAHGIQIKVATPGDHRALSAYLRKENIGFHTYALQEDRELRVVIRGVPKELEIDYIKEDLTAQALPIVSVHRMHSGRGKQPYNMILVALEPTPEAKKKIACLTTICGLSGISIEAPHKRGTPGQCYRCQLYGHSARNCHARPRCVKCLGDHATLDCVRDRETATEPPSCVLCLKQGHPANYRGCPTAPRKHPTPRTVGPKTSAPSVPKPAFVPAAVPTVSAWKKPLPYTKAGTETAPPPPLVTRPAPQPLLAPRPAPAFRPPQPSAVNDFALVRDFVTAVNFDRLRSFADAIRRNDRLTASKGGTAIYYRRALHVVPLDTPSLSHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIVGPPTPTCYPYNIALRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPHNPVTVTKTMVDWNKLGTCLADAAPPILPYGPDSNPSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSPDLRNLLRVRNAAIRAYDRLPTHSNRIQMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLLRPSGQPPAFDDDDKAELLADALQEQCTTSTQQADPEHTELVDREVERRASLPPSDALPPITTDEVRDAILNLQPRKAPGSDGIHNRALKFLPVQLIAMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPTNETSSYRPISLLSTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATMGQWFRKWRIDINPTKSAAVLFKRGRPPNITSSIPLRSRRANTSAVSPITLFGQPIPWVSKVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPKLCSRSKLSLHNKVTLYKTCIRPVMTYASVVFTHAARTNLKSLQVIQSRFCRIAVGAPWFLRNVDLHDDLELDSFSKYLQSASLRHFEKAARHENPLIVAAGNYIPDPVDRMIEEMVLTRSEKMRSSRLDRPGNEAVSGSTSQDAQQRAVSAAPRSGVTEGPPPMAATSSQSTAPRSGVTQGPPPMAAPSSQVEKCPGVPRGSQAMPPSRQILPTQYSPASPTGPNSGVCRRVVRPPSTATPATTSGDAATESVVSASQNRKESALTANQIVHGSHITDAAAKISTTEEGSTLRDGMAPPVRGSSRKSSQQSQRLLLMARLKEEHLRAKEEQARLRAELAAARISTLEAEALVEEEEDARTTLTEDENEQSQRIDTWLSQQRSIALHGVEERVMQPTHGSPATIEQPQLELPAPIEQLKLPAPAAAPIAAPVAPKSDIAELAAAIATAARQARPGPSHRYYGELPVYSGSHQEWLSFKVAYAESADSFSAAENTARLRRTLRGRAREAVENLLLHYTEPAEIMRTLESRFGRPEAIAATELERLRALPRCTDTPRDICVFANKVNNVVAALRALDRVHYMYNPELTNITSEKLPSTLRHRWFEFSATQPAGEPDLVKLSRFLQREADLCSPYAQPEPETRVENTSGRRKMVNTPQRTHTTQAKEERKCAACQKPGHIPQDCPEFKRAAVSERWDTAKRENLCFRCLRFRSRGHVCKKKKCGVDSCERTHHELLHKKPAWQKPKEKEEAVTSTWAARSATAYLKMAPITVIGPAGEADTWALLDDGSTISLIDEDFARRVGAKGPIEPLFITAIGDNKIDATRSRRVPLKLCGRTGEPQELNLRTVNGLKLTPQRLNIEVLASCHHLTDLSHHFKTSYASPKILIGQDNWHLLVTEEMRTGRRDQPVASRTPLGHYFAIEGLTVAAKTPKNDPDERALKILRETTQQRPDGRYETALLWREESLKMPNNLEAALNRLTSVEKKLEKDPNLKERYKQQMDALVAKGYAEVTPSTGTKKRTRYLPHFDVTHPMKQEKPRIVHDADAKNRGKKPKRLPAHRPGPAAVVARSDDALQAARRRRLRGHHGDVYTDRRPKRGPRRAPVLVEGGPFTRAHRIPDEYPDAADLKLHTYVDTNKYAHDAALYWRVETPDGETRTSLAKARVAPMKPTSTPRLELQADVMGSRIAAAVTGKHYRKPDTSVLDRQRHHRREQHCGGMALEETGEEKCATLAVSRESLGEAIPDPRRFSKWEKYLRATGRILQFVSLCRRSRERTHYKRTRRNPRSDPTWEKNRKKTTSKTPLNTPRTPEQAVIQWKTLDADTLRRAETLIWQQSQRAAFEEEILTLQRGKQISPASRLRNLSVTYADGILKINGRIGNIEGADVITSPLVLDGSRRETRLMIDFIHRKMHHAGTEATIAECRQSTLHRVQPQATTHRADWHTIGDHSHTWASITSGPIKSPPAEAPRSTTWPSSHVSRAVHLEPAASLSTDSAVMALRRMIARRGAPTEIWSDNGTNLRGADKELRQALDKATEHEASLRLTQWRFIPLGAPFMGGAWERMVRAVKAALSATEQPRHPTPEIFHTLLAEAEFTVNSRPFTHVSVSADDPDPLTPNHFLLGGPARVPVPGKFDDADLIGRAHWRAAQRLADVFWSRWLREYLPDLQNRREPHSRGPALKIGDVVIIADGTLPRNTWPRGIIQEVYPGADGITRVVDVRTAGGILRRPAKKIIVLPTMSAAHQGGCSDVNDAARREDVRDGHK

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.003366,     Score=104

Ontologies

Topology

Length:
2901
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0503800000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  2901
 
 

Population Genetic Test Statistics

Pi
213.339973
Theta
147.396056
Tajima's D
2.071978
CLR
1982.710877
CSRT
0.892405379731013
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号