SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14588
Pre Gene Modal
BGIBMGA008783
Annotation
PREDICTED:_zinc_finger_protein_37-like_isoform_X3_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.773 Extracellular   Reliability : 1.159 Nuclear   Reliability : 1.326
 

Sequence

CDS
ATGGATACCGAAGTACGAATGTATTTCGGGAGATGCAGATGTTGCTTAGAATATGGTTATTTAAAATACATGTTTTTTGAACACAAACATCGAGGACAGGTCGAGATTTACGGCGAAATGTTAAAGAACTGCTTCAATTTTTCTTGGATCCAATTAGACACGGAGGACTATAATCAGATCTGTGATCCGTGCATCAAGAAGCTAAGAGAGGCGTGCAGTTTTAGGAATTTAGTTATAAGATCCCAGAAGCAACTGCTTGATGAAATATGTAATAGTGAAGAACCAGCAATAAAAGTGGAATATATAAATGAAGTGGAACAAGATTCATTATTGGAGCCGGTGCAATGGGAAGGTGGGTATGAAGAAATGAAATAG
Protein
MDTEVRMYFGRCRCCLEYGYLKYMFFEHKHRGQVEIYGEMLKNCFNFSWIQLDTEDYNQICDPCIKKLREACSFRNLVIRSQKQLLDEICNSEEPAIKVEYINEVEQDSLLEPVQWEGGYEEMK

Summary

EMBL
BABH01037794    BABH01037797    BABH01037798    BABH01037799    BABH01037800    BABH01037801    + More
KZ150324    PZC71397.1    NWSH01001894    PCG69768.1    RSAL01000113    RVE47010.1    KZ150113    PZC73304.1    ODYU01006258    SOQ47936.1    KQ459805    KPJ19890.1    KQ460130    KPJ17537.1    BABH01037827    BABH01037828    BABH01037829    GAIX01004054    JAA88506.1    RVE47005.1    ODYU01006648    SOQ48679.1    KQ459348    KPJ01310.1    JTDY01000653    KOB76327.1    PZC71395.1    KZ149901    PZC78538.1    PCG69769.1    ODYU01005781    SOQ47000.1    KQ460500    KPJ14225.1    KPJ01321.1    RSAL01000335    RVE42466.1    GDQN01007573    JAT83481.1    NWSH01000112    PCG79437.1    NWSH01000101    PCG79547.1    AGBW02008655    OWR52852.1    KPJ19902.1    GDQN01010435    JAT80619.1    KPJ14213.1    GDQN01002043    JAT89011.1    NWSH01003163    PCG66841.1    AGBW02008654    OWR52857.1    RVE47007.1    ODYU01005382    SOQ46166.1    ODYU01003237    SOQ41733.1    AGBW02007657    OWR54805.1    BABH01037786    BABH01037787    BABH01037788    NWSH01002560    PCG67980.1    KPJ01332.1    ODYU01006883    SOQ49125.1    JTDY01002272    KOB71753.1    NWSH01001274    PCG71891.1    OWR52854.1    GDQN01005067    JAT85987.1    OWR52853.1    PCG79548.1    PZC73310.1    GAIX01005209    JAA87351.1    GDQN01009814    JAT81240.1    KPJ01322.1    RVE47009.1   
Pfam
PF00096   zf-C2H2        + More
PF07776   zf-AD
PF05225   HTH_psq
Interpro
IPR013087   Znf_C2H2_type        + More
IPR036236   Znf_C2H2_sf       
IPR009057   Homeobox-like_sf       
IPR012934   Znf_AD       
IPR007889   HTH_Psq       
SUPFAM
SSF57667   SSF57667        + More
SSF46689   SSF46689       

Ontologies

Topology

Subcellular location
Nucleus  
Length:
124
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00303
Exp number, first 60 AAs:
0.00303
Total prob of N-in:
0.23927
outside
1  -  124
 
 

Population Genetic Test Statistics

Pi
179.07213
Theta
156.708323
Tajima's D
0.343389
CLR
0
CSRT
0.474326283685816
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号