SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14585  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA008750
Annotation
PREDICTED:_PR_domain_zinc_finger_protein_5-like_isoform_X1_[Bombyx_mori]
Transcription factor
Location in the cell
Nuclear   Reliability : 4.381
 

Sequence

CDS
ATGGACGAAATAAGTAATGGCCATGAACCAGCAATAAAAATTGAGTATGTAAATGAAGCAGAGAAAGACTCATCAGAACCAGAACTCACGAGGGATAGTGTGTATGAAGAAGTGGAATTCTTAGATGTTCCTGTTGATGTCAAACCAAAAGAGAAAGTAGACAGAAAAATAATGACCACCGGTCCAACAAAGAGAAAACTTCCAAACAGGCAAGCGAAGAACATTGAAAATAGGTTAACGAAATATGCCATAGGAGACCCAGAGAAGACGATGGTTGTATCGAGAAGCAAAAAAATCTTACGTATAGATACTACAAATCACAATGGGATTTCAAACAAAATCTTAAACGAGAAATTGGATGAAGTTTCAGATAAACAGACTTTGGTGCCAAAAATAGAATTCTTAGAAGTGGAAAGCCAAGAAATCGTTGAAGAAATTAACAAGAATGAAGAAATTGGACTCGAGAAGAAAACATATGATGAAGTGGAGTATTTAGAGGAAGATGTCACAAATAACAGTCAACCAGAGAAAGATCCGATAACAGTCTGCTTAACCCGGCCCAAGAAACTGCCCCGGGCCAAACCCATCAAGAAATACCTTCAATACACCGAGGAGGACCTGAGGAATGGCGTGGAAGCAGTCAGAAACAACAGGATGTCTAGATTAGAAGCGGCCGAGTTCTATAACGTTCCGAGGAAGACTTTAGTTGCCAAACTCAAAATGGACGAGGAGAATGTCCGGGAAGTGGCAACCGTCGACGCCGGTACTAAGATCGGTAAAGGTGAGACGGACGTACGGGCGCGGTACAAAGCGATCGTTCGATGTAAAACACGTAGCGCGCCCGAGAACACATCCGCTCTAGAGATGACAAAGCACAAGGACAACATAAGAATGGTCATGCAACACTCGAATGCGACTCTGATCAGAGACCACCGCGGCGCCGGGTATTCTTGCTGCTTCTGCACGGAACGTTTCCAGACTCCGGCGCTGCTGAAACAGCACAATCTCAATATACACGAAGATGCCGGCCAAAACGCGATCAGGGTTAAATACGTGTCCGATCTCATACTTAAACTGGATGTAACGGGACTCCGGTGCTTAATTTGCGCGGCCAAGATCGAAACCCTTGAAGCGTTCTTGGAACATCTGAGGAAGGACCACAAGAAAACCTTCCACGCTGACGTCAAGTCTCACATGGTTCCGTTCAAATTCGAAGGAGAGGTATTAGAATGTGCGATCTGTAAGAAGCGATTTAAATATTTCAAGCTGCTAGCGGAACATATGAACGATCACTACAGGAACTACGAATGCTCCGTATGCGGACGAGGATTTGTGAACAAGCAAGCTATGCAGCTACATTCATATCGGCACCAGAAAAACGTCGGCGAATTCAAGTGTCCAGATTGCCCGAAAGTATTTGACACGCGGCCTCGTCGAAGTGCTCACGTTAGGCTTGTCCACCGTCACGGCAGGAAGACGAGGCGATGTCATCTCTGCGAAGAGAAGTTCGTATCCGCCCAGCAGGTCCAGAATCATATGGTCAAAACCCACGGAGCCAAGCAGCAAGTGTTCAAGTGCGATGCTTGCGATCGGACGTACACCGTCGCCAGGTCTCTCGACGAGCACAAGAAGCGTTACCATCTGATGCTCCGACCGCACCAGTGTACCCTGTGCGAGATGAGTTTCTACTCCAAGATGGAGCTGAACTCGCACATGGTCACACATACAAAGACTAGGGAGTTTCAGTGCGAGTTGTGCGATAAACGTTTCGGTACTAAATGCTCTCTCAACCAGCACATGAGAGCGCATTACGGTATAAAGCGCTACAAGTGCGACCGTTGCGATGTCAAGTTCGCCGCCAAAAACAAACTAAGGGCTCACTGCTGGAAGAAACACGGCGAGAGCGTAGACCCAGCACGAGAAGAAATGTATGTATTCATAAAGGAAGTAAAAAAAATACTCTCATTCACGAATGCGACGCCCTACAAAAGTAAAATATCGACTTACAGCTGCGCCTATTGCACCGAAGTGTATTTCCACGCGGCGGACGACCTCCGCAACCACACGCGCACGAACCACATCGACGAGCGAACGAAGAAGGTCGACCTCATGATGAGACCTCACGCGATGAACGAAATCTTAAAGTTGGACGTGAACAATCTCATTTGTGTGGTGTGTTGCATCCCGATGGACGACTGGAATGGTCTATTTAGACATTTAAAAAATACACACGGTGTCGTCTTCACGTACGCGTACAAAAGGGTCATTCCGTATATCTTGGACGAGGAGCCTGACTGCGTGCTCTGCAAGCAACACTTCACGAACTACATTCAGCTGGACTTCCACATGAACAGCCACTACGACAACTACGTCTGTGACGATTGCGGCCAGACCTTTATATCCGCTGCCAGATTAAAGAATCACGCCAAGAATCACTCCAAGAAGCAAGAAGCGGTCGTTCACAAAGCCAGGTTGTACTACAAGTGTTACTACTGCCCGGAGAAACTGCCGAGCGAAAGGGAGAGGAAGGAGCACATCGAAGCAAACCACAGGGAGAAAATTAAGGAGATCGGCTGCGACATGTGCGGCAAGATATTCAATTGGCGGCAGTACTACATCGAGCACTTGAGGAAGGTCCATGGCGACAGGAAATACGAGTGCACAGCTTGCGATAAAAAGTTTTCTCAGAATAGAGATTTGAGGCGGCACGTCGAGTCCAGGCATAACGGCGCCAAGAACCACGTGTGTCCGATGTGCGAAAGGAGATACTCCTCGAAAGCGGCGCTGGGACATACAGAGGTGTACGGCGAAATGTTAACGAAATGCTACGCTTTTTCGTGGATCCAGTTAGACTCTGAAGATTACAATCAAATCTGTGATCCATGCATAAAGAGGCTAAGGGAGTCGTGCAGTTTTAGGAATTTAGTTATAAGATCCCAGAAACAACTGATGGACGAGATAAGTAATGGCCATGAATCAACAATAAAAATTGAGTATGTAAATGAAGCAGAGAAAGACTCATCGGAGCCAGAACTCATGAGGGATAGTGTGTATGAAGAAGTGGAATTTTTAGATGATGTTCCTGTTGATGTCAAACCGAAAGAGAATGTAGACAGAAAAAGAATGAGCATCAGTCCAACAAAGAGAAAACTTCCGAACAAACAAGCAAAGAACATTGACAATAGGTTAACAAAATATGTTGTGGGAGACCCAGAGAAGACTATGGATGTGTCGCGAAGTAAAAAAAACTCACGTATAGATACTACAAATCACAATGGGAATTCAAATAGAATGTTGACTGAGGAATTGGATGAGTATTCAGATAAACAGACTTTGGTGCCAAAAATTGAATTCTTAGAAGTGGAAAGCCAAGAAATCGTTGAAGAAATTAACAAGGATGAGGAAATTGGACTCGAGAAGAAAACATATGAAGAAGTGGAGTATTTAGAGGAAGATGTTACAGACAACAGTCAACTAGAGAAAGATCCGATAACAGTTTGCTTAACCCGGAAATGGCCCAAGAAACTACCCCGAGCCGAACGCAACAAGAGGTATCTTCAGTACACCGAGGAGGATCTGAGGAATGGCGTGGAGGCAGTCAGAAACAACAGAATGTCTAGATTAGAAGCGGCTGAATTCTATAACGTTCCGAGGAAGACTTTGGCTGCCAAACTCAAAATGGACGAGGAGAGTGTAGACCCGGCACGAGAAGAGATGTACGTATTCATAAAGGAAATAAAAAAAATACTCTCATTCACGAATGCCACGCCCTACAAAAGTAAAATGTCCACCTACAGCTGCGCCTATTGCACCGAAGTGTATTTCCAAACGGCGGACGACCTCCGCAACCACACGCGCACAAACCACATCGACGAGCGAACGAAGAAGGTCGACCTCATGATGAGACCTCACGCGATGAACGAAATCTTAAAGTTAGACGTGAAAAACCTCATTTGTGTGCTGCCAAGCGATAGGGAGAGGAAGGAGCATATCGAAGCGAACCACAGGGAGAAAGTTAAGGAGATCAGCTGTGACATGTGCGGCAAGATATTCAATTGGCGGCAGTACTACATCGCGCATCTGAGGAAGGTCCATGGCGACAGGAAATACGAGTGCACAGTTTGCGATAAAAAGTTTTCTCAGAATGGAGATTTGAGTCGGCACGTCGAGTCCAGGCATAACGGCGCCAAGAACCACGTGTGTCCGATGTGCGAAAGGAGATACTCCTCGAAAGCGGCGCTGGTGACGCACTTCAAAATTCATTCGAACAATAACGAAGTTGTCGTTATAAATTACACATAA
Protein
MDEISNGHEPAIKIEYVNEAEKDSSEPELTRDSVYEEVEFLDVPVDVKPKEKVDRKIMTTGPTKRKLPNRQAKNIENRLTKYAIGDPEKTMVVSRSKKILRIDTTNHNGISNKILNEKLDEVSDKQTLVPKIEFLEVESQEIVEEINKNEEIGLEKKTYDEVEYLEEDVTNNSQPEKDPITVCLTRPKKLPRAKPIKKYLQYTEEDLRNGVEAVRNNRMSRLEAAEFYNVPRKTLVAKLKMDEENVREVATVDAGTKIGKGETDVRARYKAIVRCKTRSAPENTSALEMTKHKDNIRMVMQHSNATLIRDHRGAGYSCCFCTERFQTPALLKQHNLNIHEDAGQNAIRVKYVSDLILKLDVTGLRCLICAAKIETLEAFLEHLRKDHKKTFHADVKSHMVPFKFEGEVLECAICKKRFKYFKLLAEHMNDHYRNYECSVCGRGFVNKQAMQLHSYRHQKNVGEFKCPDCPKVFDTRPRRSAHVRLVHRHGRKTRRCHLCEEKFVSAQQVQNHMVKTHGAKQQVFKCDACDRTYTVARSLDEHKKRYHLMLRPHQCTLCEMSFYSKMELNSHMVTHTKTREFQCELCDKRFGTKCSLNQHMRAHYGIKRYKCDRCDVKFAAKNKLRAHCWKKHGESVDPAREEMYVFIKEVKKILSFTNATPYKSKISTYSCAYCTEVYFHAADDLRNHTRTNHIDERTKKVDLMMRPHAMNEILKLDVNNLICVVCCIPMDDWNGLFRHLKNTHGVVFTYAYKRVIPYILDEEPDCVLCKQHFTNYIQLDFHMNSHYDNYVCDDCGQTFISAARLKNHAKNHSKKQEAVVHKARLYYKCYYCPEKLPSERERKEHIEANHREKIKEIGCDMCGKIFNWRQYYIEHLRKVHGDRKYECTACDKKFSQNRDLRRHVESRHNGAKNHVCPMCERRYSSKAALGHTEVYGEMLTKCYAFSWIQLDSEDYNQICDPCIKRLRESCSFRNLVIRSQKQLMDEISNGHESTIKIEYVNEAEKDSSEPELMRDSVYEEVEFLDDVPVDVKPKENVDRKRMSISPTKRKLPNKQAKNIDNRLTKYVVGDPEKTMDVSRSKKNSRIDTTNHNGNSNRMLTEELDEYSDKQTLVPKIEFLEVESQEIVEEINKDEEIGLEKKTYEEVEYLEEDVTDNSQLEKDPITVCLTRKWPKKLPRAERNKRYLQYTEEDLRNGVEAVRNNRMSRLEAAEFYNVPRKTLAAKLKMDEESVDPAREEMYVFIKEIKKILSFTNATPYKSKMSTYSCAYCTEVYFQTADDLRNHTRTNHIDERTKKVDLMMRPHAMNEILKLDVKNLICVLPSDRERKEHIEANHREKVKEISCDMCGKIFNWRQYYIAHLRKVHGDRKYECTVCDKKFSQNGDLSRHVESRHNGAKNHVCPMCERRYSSKAALVTHFKIHSNNNEVVVINYT

Summary

Uniprot
ProteinModelPortal
PDB
5V3M     E-value=2.22383e-20,     Score=249

Ontologies

Topology

Length:
1433
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1433
 
 

Population Genetic Test Statistics

Pi
215.674552
Theta
181.495523
Tajima's D
1.111376
CLR
0.188471
CSRT
0.692265386730664
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号