SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14558
Annotation
retroelement_polyprotein_[Glyptapanteles_flavicoxis]
Location in the cell
Nuclear   Reliability : 1.157 Peroxisomal   Reliability : 1.094
 

Sequence

CDS
ATGTGTGTAGACTACCGAGAGTTAAATAGGAATACCGTCAGGGACCATTATGCCTTACCGATAATCTCAGACCAAATAGACCAACTGGCCGGGGGTATTTATTTCACCACAATTGACATGGCAGCTGGGTTTCATCAGATACCTATTTCGGAGGGATCAATTGAAAAGACTGCTTTTGTAACTCCCGATGGTTTATATGAATACCTAACTATGCCATTTGGACTTTGCAACGCGGTGTCAGTCTACCAGCGCTGCATTAATAGGGCTCTCGCTCACCTCACGAGCTCACCAGACCAAGTGAGCCAGGTCTATGTCGATGATGTGCTCTCAAAGTGTAAAGATTTTGATCAGGGCTTATACCATATTGAACGCATATTGATTGCTCTACAAGAAGCTGGCTTTTCTATTAACGTTGATAAAACCGCCTTCTTTAAACGCTCCATCGAGTACTTGGGCAATATAATTGCAGACGGGCAGGTCAGCCCTAGCCCAAGAAAGGTGGAGGCTTTAACGAAGGCACCAATCCCGAAAACTGTCAAACAAGTTAGACAATTCAATGGCCTGGCTGGATATTTCAGACGTTTCATTCCCAACTTCTCGCGAGTTATGGCTCCTTTATATGAACTCACTAAGAACGATACGACACGGGAATGGAACGAAAGGCATGACGAAGCTAGGGATTATATTGTCAAACATCTGTCTACTGCGCCTACCCTTACGCTATTCCAGGAAGACGCACCCATCGAACTCTACACGGACGCCAGCAGCATCGGCTACGGGGCAGTGTTAGTGCAGACATTCGCGGGTCGCCAACATCCAGTCGCGTACATGAGCCAGCGCACCACCGACGCCGAGAGCCGCTACCACTCTTACGAACTTGAAACGTTGGCGGTCGTAAGAGCAATTAAGCATTTTCGGCATTACCTCTACGGCCGAAAATTCAAGGTAATAACCGACTGTAATGCTCTCAAGGCCTCCAAAAACAAAAAGGACTTGCTTCCGCGAATCCATCGGTGGTGGGCGTTTTTGCAAAACTACGAATTCGAGGTGGAGTATAGGAAAGGTGAGCGATTACAGCACGCACTTTTTCAGTAG
Protein
MCVDYRELNRNTVRDHYALPIISDQIDQLAGGIYFTTIDMAAGFHQIPISEGSIEKTAFVTPDGLYEYLTMPFGLCNAVSVYQRCINRALAHLTSSPDQVSQVYVDDVLSKCKDFDQGLYHIERILIALQEAGFSINVDKTAFFKRSIEYLGNIIADGQVSPSPRKVEALTKAPIPKTVKQVRQFNGLAGYFRRFIPNFSRVMAPLYELTKNDTTREWNERHDEARDYIVKHLSTAPTLTLFQEDAPIELYTDASSIGYGAVLVQTFAGRQHPVAYMSQRTTDAESRYHSYELETLAVVRAIKHFRHYLYGRKFKVITDCNALKASKNKKDLLPRIHRWWAFLQNYEFEVEYRKGERLQHALFQ

Summary

EMBL
GBHO01040014    GBHO01031163    JAG03590.1    JAG12441.1    GDHC01016400    JAQ02229.1    + More
GBHO01041313    JAG02291.1    EF710649    ACE75273.1    GBHO01032413    JAG11191.1    GBHO01032415    JAG11189.1    GBHO01040010    GBHO01001812    JAG03594.1    JAG41792.1    RSAL01000274    RVE43148.1    GDHC01004980    JAQ13649.1    GBHO01030786    JAG12818.1    GBHO01036023    GBHO01032007    JAG07581.1    JAG11597.1    GALX01002922    JAB65544.1    GEZM01007614    GEZM01007613    GEZM01007612    JAV95056.1    GEZM01007616    GEZM01007615    GEZM01007611    JAV95051.1    KQ971345    EFA05054.2    GDQN01011434    JAT79620.1    X14037    CAA32198.1    LBMM01008871    KMQ88569.1    GEZM01089268    GEZM01089261    JAV57577.1    GEZM01089269    GEZM01089265    JAV57567.1    KQ971339    KYB27733.1    GBHO01041187    GBHO01040948    GBHO01039116    GBHO01000859    JAG02417.1    JAG02656.1    JAG04488.1    JAG42745.1    GBHO01041099    GBHO01037897    JAG02505.1    JAG05707.1    GBHO01037851    JAG05753.1    GDQN01009269    JAT81785.1    GBHO01043544    GBHO01031946    GBHO01031931    GBHO01022910    GBHO01022909    GBHO01015498    GBHO01001135    GBHO01001106    JAG00060.1    JAG11658.1    JAG11673.1    JAG20694.1    JAG20695.1    JAG28106.1    JAG42469.1    JAG42498.1    GALX01001723    JAB66743.1    GBHO01022918    GBHO01006165    GBHO01006163    GBHO01001110    JAG20686.1    JAG37439.1    JAG37441.1    JAG42494.1    GBYB01013920    JAG83687.1    GBHO01041008    GBHO01006162    GBHO01001134    GBHO01001105    JAG02596.1    JAG37442.1    JAG42470.1    JAG42499.1    KQ971338    KYB27887.1    KYB27888.1    KQ971701    KYB24754.1    KYB27885.1    KYB27886.1    GGMR01015682    MBY28301.1    GDHC01018907    JAP99721.1    GEZM01005427    JAV96179.1    GGMS01015422    MBY84625.1    GGMS01012726    MBY81929.1    GGMR01009949    MBY22568.1    LBMM01002816    KMQ94326.1    KQ460883    KPJ11409.1    ABLF02004401    ABLF02013544    ABLF02013550    KZ149989    PZC75624.1    GDHC01012341    JAQ06288.1    ABLF02017401    IAAA01004057    LAA02040.1    IAAA01004056    LAA02037.1    IAAA01004058    LAA02042.1    ABLF02033943    ABLF02042737    GDHC01018562    JAQ00067.1    KZ150428    PZC70914.1    GEHC01000888    JAV46757.1    GGMR01016004    MBY28623.1    GBHO01011083    GBHO01009497    JAG32521.1    JAG34107.1    ABLF02008401    ABLF02008404    GEGO01004299    JAR91105.1    ABLF02014660    ABLF02042774    LRGB01002992    KZS05228.1    GEZM01051217    GEZM01051215    JAV75083.1    GBXI01005773    JAD08519.1    ABLF02004526    ABLF02054969    GBHO01015604    JAG28000.1    GBBI01004477    JAC14235.1    ABLF02013955    ABLF02009677    ABLF02021755    ABLF02021756    ABLF02021757    ABLF02021758    ABLF02021759    ABLF02021760    ABLF02022031    ABLF02041876    LBMM01011782    KMQ86633.1    ABLF02022032    GGMR01018192    MBY30811.1    LBMM01005919    KMQ91095.1    GGMR01005091    MBY17710.1    ABLF02023666    ABLF02005127    ABLF02005129    ABLF02007401    GFXV01005120    MBW16925.1    LBMM01010976    KMQ87102.1    KMQ91096.1    GBHO01026469    JAG17135.1    GFJQ02004121    JAW02849.1    X95908    CAA65152.1    ABLF02003120    ABLF02004015    ABLF02057179    ABLF02066208    GFWV01007660    MAA32390.1    GBBI01004551    JAC14161.1    GBBI01004550    JAC14162.1    GBBI01004613    JAC14099.1    GBBI01004549    JAC14163.1    GEZM01033083    JAV84424.1    GDIP01005668    JAM98047.1    GGMR01003388    MBY16007.1    LRGB01000231    KZS20305.1    LRGB01002748    KZS06406.1    GEZM01034557    JAV83728.1    GFJQ02008169    JAV98800.1    KQ973017    KXZ75691.1    LRGB01000072    KZS21146.1    GEHC01000930    JAV46715.1    GEHC01000891    JAV46754.1    GDIQ01198582    JAK53143.1   
Pfam
PF00078   RVT_1        + More
PF17917   RT_RNaseH
PF17921   Integrase_H2C2
PF17919   RT_RNaseH_2
PF00665   rve
PF00098   zf-CCHC
PF00077   RVP
PF14392   zf-CCHC_4
PF03732   Retrotrans_gag
PF13873   Myb_DNA-bind_5
PF02145   Rap_GAP
PF02037   SAP
PF16064   DUF4806
PF09668   Asp_protease
Interpro
IPR041373   RT_RNaseH        + More
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR021109   Peptidase_aspartic_dom_sf       
IPR036397   RNaseH_sf       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR018061   Retropepsins       
IPR034122   Retropepsin-like_bacterial       
IPR025836   Zn_knuckle_CX2CX4HX4C       
IPR005162   Retrotrans_gag_dom       
IPR028002   Myb_DNA-bind_5       
IPR000331   Rap_GAP_dom       
IPR035974   Rap/Ran-GAP_sf       
IPR036361   SAP_dom_sf       
IPR003034   SAP_dom       
IPR032071   DUF4806       
IPR019103   Peptidase_aspartic_DDI1-type       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF50630   SSF50630       
SSF111347   SSF111347       
SSF68906   SSF68906       
PDB
4OL8     E-value=5.36618e-59,     Score=576

Ontologies

Topology

Length:
364
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.23388
Exp number, first 60 AAs:
0.12524
Total prob of N-in:
0.05112
outside
1  -  364
 
 

Population Genetic Test Statistics

Pi
169.43453
Theta
74.850642
Tajima's D
2.584294
CLR
0.196249
CSRT
0.953452327383631
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号