SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14557
Annotation
PiggyBac_transposable_element-derived_protein_4_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 2.496
 

Sequence

CDS
ATGAATTACCTTCTCCCTGGCCACACGGAAATGTCGGTAGACAGCATACACTCTACAATCGAACAATCCGTAAGAAATATTACTGTATGGGCCCCTTCGCAATGGGCTACAATAAGCCAGCTAGCAAGAAAAGAACCAGCACCTTATAATGAAAATCTGACACACGAGGATTTCTTAAATTTTGATGATATGTCTGAAAAATATTTTAAGGGTAACCTTGTAGGGGAGGCAGTGCAAAGAGCAACAGGCGTGCGCACTCGCGGAGGTCGTTCGAGTGTTCCCACACGTGGTGGTTCACGAAAAGGAAGGGTACGAGGTAAAGGAAGGGGGTGCCCGCGGTCTTCTGTTGAACAGAGGCCGTCGGCAAGTTGCGCATTTAACCTTATTGCAATTGAGGATTTGCCCGCTGGGGAACCGATAGAGCAGACATTGACGGAGCGAAATAAGCGTTCATGGAACCCCCGAAATTATGAACCTGACGGAGAGGACATTCCAGTAATTTTGTCTTCACCTGCGATTCCGCCATTACCGGCAATGTACGTTGAATGTGGCGGCAGTGACCAAGAACATGATACTACGAACAGAGATTCTATTTCATTGCTACGTCGACCGCTACGAGACTCTGAAATTTGCTACTTGTTGCACTATGGAAGTGACGACGATGACAGCGATGATGAGAGCCAGAATGATAACGACGAAATCGTTCCCATGATCATCCCCCGGGCAGCTGGAATACTGATGGACACTCCGGACGACGAGGAGATTGAGATTGACACGGCGGCGGCAACACCTACATCACCAGCGCGTGATACCGGTATGAAGCCTAGTCATTTTTTTGAATTTGACTGGGGAACTTTCCCTGACTCTCCTATACCGCCAACAGAAAGGCATGAATCTTTTAAGGAAAACTCTGGTCCCACTGTCACTGTAAGTGACCTTTACGAGATTTTTAGACTAATTTGGGACCAGGAGTTCATGGAATTTATTGTGCAGGAAACAAATAGATATGCCCAACAATTAGCTGCTGAAATGTTGGACGGCGGGGAATTACAGGCCTCCAGTAGGATTACAGAATGGAAAGATACCAATGTAGACGAGTTATTGGTGTTCTTCGGAATATTACTGGCGATGGGAATCGTCATAAAGAACCGGGTTGAAGAGTACTGGAATACGGAACAAAACATCTTCTCCACTCCAGGTTTCAAAGTATATATGTCGCTTAGGAGGTTCCAGTTACTCAGCAGGTGCTTACATTTTAATAATTCCGAGAACTTGAGAAACCTCAACCTGGATCCCTCACAGGCAAAGCTTTTTAAAGTGGAGCCTGTGATTAGCCATTTGAATTCCAAGTTCACGGAATTATATATAATGAAGCAGAACATTGCTTTAGATGAATCGCTGCTGCAGTGGAAAGGTTGGTTGAACATCAACCAATTTATTCCAAACAAAGCTGCAGCAGTGGGCATAAAAACTTACGAAATATCACTTGCCCGAAAATTCAAGTCGATTGGGTTTGATTGTGTCGGTACGTTGCGGACAAGCCGCAAGTATGTCCCGACGGAACTGAACAATCTGAAAAAATCTCAGATGAATCCCGGGCAAGTAGTAGGCTATACCAGTGGAGATGTCGATTGCATAATATGGAGAGATCAGAACCGCGTAGCAACGATCTCAACGTACCATGGCAATGCCGTCTCCACTAAAAACGGAGTAACAAAACTTATTTTGATACGTGACTACAACATCTGCATGGGTGGCGTGGATAAAAAAGATCAGATGTTGGCTGCATTCCCAATTGAACGCAAGAGGACACAAATTTGGTATAAGAAATTGTTTAAAAGGATTGTGTTTTGA
Protein
MNYLLPGHTEMSVDSIHSTIEQSVRNITVWAPSQWATISQLARKEPAPYNENLTHEDFLNFDDMSEKYFKGNLVGEAVQRATGVRTRGGRSSVPTRGGSRKGRVRGKGRGCPRSSVEQRPSASCAFNLIAIEDLPAGEPIEQTLTERNKRSWNPRNYEPDGEDIPVILSSPAIPPLPAMYVECGGSDQEHDTTNRDSISLLRRPLRDSEICYLLHYGSDDDDSDDESQNDNDEIVPMIIPRAAGILMDTPDDEEIEIDTAAATPTSPARDTGMKPSHFFEFDWGTFPDSPIPPTERHESFKENSGPTVTVSDLYEIFRLIWDQEFMEFIVQETNRYAQQLAAEMLDGGELQASSRITEWKDTNVDELLVFFGILLAMGIVIKNRVEEYWNTEQNIFSTPGFKVYMSLRRFQLLSRCLHFNNSENLRNLNLDPSQAKLFKVEPVISHLNSKFTELYIMKQNIALDESLLQWKGWLNINQFIPNKAAAVGIKTYEISLARKFKSIGFDCVGTLRTSRKYVPTELNNLKKSQMNPGQVVGYTSGDVDCIIWRDQNRVATISTYHGNAVSTKNGVTKLILIRDYNICMGGVDKKDQMLAAFPIERKRTQIWYKKLFKRIVF

Summary

Pfam
PF13843   DDE_Tnp_1_7
Interpro
IPR029526   PGBD       

Ontologies

GO

Topology

Length:
617
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.144090000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00080
outside
1  -  617
 
 

Population Genetic Test Statistics

Pi
322.233974
Theta
224.819696
Tajima's D
0.563007
CLR
0.918794
CSRT
0.534973251337433
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号