SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14552
Pre Gene Modal
BGIBMGA013783
Annotation
AF461149_1_transposase_[Bombyx_mori]
Full name
Signal transducer and activator of transcription      
Location in the cell
Mitochondrial   Reliability : 2.127 Nuclear   Reliability : 2.205
 

Sequence

CDS
ATGAAGACTAGTGTAGATGACAGGTCAAGAAGTGGTCGCCCTCGGTCTGTTAGGACTCCAGCAGTGATAAAAGCTGTGAAGGCGCGAATTCAAAGAAATCCCAAACGTAAGCAGAAATTGTTGGCCCTTCAGATGGGGTTAAGCAGAACCACGGTGAAAAGGGTGTTAAATGAAGACTTAGGGCTTCGGGCATATCGAAGAAAAACAGGACATCGTTTGAATGCTCGTCTAATGGACCTGAGACTGAAGAGATGCCGCGCTTTGTTGAAGCGGCACTGGGTATTCCAACAAGATTCGGCGCCAGCTCATAGAGCGAAGAGCACACAAGACTGGCTGGCGGCGCGTGAAATCGACTTCATCCGGCACGAAGACTGGCCCTCCTCCAGTCCAGATTTGAATCCGTTAGATTACAAGATATGGCAACACTTGGAGGAAAAGGCGTGCTCAAAGCCTCATCCCAATTTGGAGTCACTCAAGACATCCTTGATTAAGGCAGCCGCCGATATTGACATGGACCTCGTTCGTGCTGCGATAGACGACTGGCCGCGCAGATTGAAGGCCTGTATTCAAAATCACGGAGGTCATTTTGAATAA
Protein
MKTSVDDRSRSGRPRSVRTPAVIKAVKARIQRNPKRKQKLLALQMGLSRTTVKRVLNEDLGLRAYRRKTGHRLNARLMDLRLKRCRALLKRHWVFQQDSAPAHRAKSTQDWLAAREIDFIRHEDWPSSSPDLNPLDYKIWQHLEEKACSKPHPNLESLKTSLIKAAADIDMDLVRAAIDDWPRRLKACIQNHGGHFE

Summary

Similarity
Belongs to the transcription factor STAT family.
Belongs to the TGF-beta family.
Pfam
PF01017   STAT_alpha        + More
PF02864   STAT_bind
PF00017   SH2
PF02865   STAT_int
PF00019   TGF_beta
PF02801   Ketoacyl-synt_C
PF00109   ketoacyl-synt
PF16197   KAsynt_C_assoc
PF13358   DDE_3
Interpro
IPR009057   Homeobox-like_sf        + More
IPR012345   STAT_TF_DNA-bd_N       
IPR008967   p53-like_TF_DNA-bd       
IPR013799   STAT_TF_prot_interaction       
IPR013800   STAT_TF_alpha       
IPR013801   STAT_TF_DNA-bd       
IPR000980   SH2       
IPR015988   STAT_TF_coiled-coil       
IPR001217   STAT       
IPR036535   STAT_N_sf       
IPR036860   SH2_dom_sf       
IPR001839   TGF-b_C       
IPR029034   Cystine-knot_cytokine       
IPR017948   TGFb_CS       
IPR015615   TGF-beta-rel       
IPR032821   KAsynt_C_assoc       
IPR014031   Ketoacyl_synth_C       
IPR020841   PKS_Beta-ketoAc_synthase_dom       
IPR016039   Thiolase-like       
IPR014030   Ketoacyl_synth_N       
IPR038717   Tc1-like_DDE_dom       
SUPFAM
SSF46689   SSF46689        + More
SSF48092   SSF48092       
SSF47655   SSF47655       
SSF49417   SSF49417       
SSF55550   SSF55550       
SSF57501   SSF57501       
SSF53901   SSF53901       
PDB
5CR4     E-value=1.18984e-07,     Score=130

Ontologies

Topology

Subcellular location
Cytoplasm  
Nucleus  
Secreted  
Length:
197
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00063
Exp number, first 60 AAs:
0.00063
Total prob of N-in:
0.37403
outside
1  -  197
 
 

Population Genetic Test Statistics

Pi
140.835052
Theta
86.02075
Tajima's D
2.582653
CLR
0.474186
CSRT
0.950302484875756
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号