SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14547
Pre Gene Modal
BGIBMGA014408
Annotation
PREDICTED:_uncharacterized_protein_LOC105841853_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.992
 

Sequence

CDS
ATGGAAGAAGTAGTTGAAGGATCGTTCCAGGAGCCTACTTGTCCACCTACCGGATGCGGCGATGCTGAATTGGCGGCTTATCAACAACAAAAAGATAAGTTTGATAAAACTGATGCCAGCGCTATCCTAATACTTACCACCAATATGCAAGAAGACACACTTCGAAAAGTGATGCGGTTCACTAAAGTACGTGATGTCTGGTTAGAGCTCCACAGGCTGTTCGACGGAACAAATGAGGACAAAACCTACAACCTGTGTATGAGTTTCTTCAGCTTTAAGAGGGATCAAGCAGACAACATAGCTACCCACATGTCAAAATTAAAGAACATTTGGACTGAACTGAATCAAGAACTCAAGAAGGACAATAACCAAGAGCTACCCGAACTGCTACTTGTTTGTAAAATACTGGACACGCTTGACGATTTATACTTCAGCTTCAGAAGTAGTTGGCTCCTCCTGCCCAAATCCAACCGTACTGTAGAAAGCCTAACTAGTCATCTCTGCGCATTTGAAAGGGCACTGCAAGGTAACAATGTACCTTCGCATCATTCGGAAGCCCTGGTTTCGAATACGGAGAAGAAGAAGGACAAGAAGCTTAAATGCAACTACTGCCTAGGTTTTGGCCACAGAGTACGCAACTGTCAAAAATGGATCCGTGACGGTAAACCTCCTAAGTGCCAAAATCCGACCCAGACAGCAACGCCTTCTACTTCAAAGACCGCTAATTTGCTACTCATGTCTTTAGAAGACAACGAAATCTTCACAGTTTCACGGGACAACGAGAGCTGTTACATAGATAATGGTGCAACAAGCCACGTCACCAACAGAGCTGACATTTTCCAAACCTACGAACATTTCAATGAGAACTACACTGTTACAACGGCCGCTGTCGGACACACCATAAAATGCCTGCTAAGTGACAACGGCGGTGAATTTGACAACGCATCCATGAAAAATGTTTTAGACACTCATGGAATAGCACAGCGACTCATCACCCCGTATACACCTGAACAAAACGGAGTAAGCGAAAGGGAGAACAGAACCCTAGTTGAGACAGCAAGATCAATGATGTACGCTCATGAGCCATTACCGCAAGTGCTATGGGCAGAGTTCATTAATACTGCCGCATACATACTAAACAGAACAGGTCCCACAAGTTCAGATAAATCTCCGCATGAACTTTGGTATGAAAAGAAACCTATTATTAAACATCTCCGAATAATAGGCTCAATCGCATACGTCCATATTCCAAAGCAGAAGCGTAGAAAATTCGACAAAAAGGCGATAAAAGGTCGACTTATCGGGTACGACGAAGATTGCTACCGTATCTGGGTCACAGACGGAAAACAGTCGACGCTCGTCCGCTCTCGTGATGTAATTTTCGATGAGAAACCTCTTCCCATCTGTAATAGTGAAATTCCTAAAACAGAAGTTGAGAAACAGAAGTTGTATACCCGATTACCATAA
Protein
MEEVVEGSFQEPTCPPTGCGDAELAAYQQQKDKFDKTDASAILILTTNMQEDTLRKVMRFTKVRDVWLELHRLFDGTNEDKTYNLCMSFFSFKRDQADNIATHMSKLKNIWTELNQELKKDNNQELPELLLVCKILDTLDDLYFSFRSSWLLLPKSNRTVESLTSHLCAFERALQGNNVPSHHSEALVSNTEKKKDKKLKCNYCLGFGHRVRNCQKWIRDGKPPKCQNPTQTATPSTSKTANLLLMSLEDNEIFTVSRDNESCYIDNGATSHVTNRADIFQTYEHFNENYTVTTAAVGHTIKCLLSDNGGEFDNASMKNVLDTHGIAQRLITPYTPEQNGVSERENRTLVETARSMMYAHEPLPQVLWAEFINTAAYILNRTGPTSSDKSPHELWYEKKPIIKHLRIIGSIAYVHIPKQKRRKFDKKAIKGRLIGYDEDCYRIWVTDGKQSTLVRSRDVIFDEKPLPICNSEIPKTEVEKQKLYTRLP

Summary

Pfam
PF13976   gag_pre-integrs        + More
PF00665   rve
PF07727   RVT_2
PF00098   zf-CCHC
Interpro
IPR013103   RVT_2        + More
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR036397   RNaseH_sf       
IPR025724   GAG-pre-integrase_dom       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D
PDB
6EX9     E-value=0.00422161,     Score=96

Ontologies

Topology

Length:
488
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01049
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00101
outside
1  -  488
 
 

Population Genetic Test Statistics

Pi
429.495
Theta
234.454307
Tajima's D
2.718784
CLR
0
CSRT
0.96275186240688
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号