SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14532
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.306
 

Sequence

CDS
ATGGTCAGGAACGACAGGCTCTCTGCTCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGGCACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCACTGCTCGGCATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACACCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATGTACTCGACATAGCGTTATTAAAAAACGTAACTCTGAGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGACTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCAACATTAGATAGATCATCGAAACAAGTTGTAGCGGAGGATTTCCTTCACCGCTTCAAATTGTCCGATGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTTGATGATGACGAAAAAGCAGAGTTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGTCTCCTTGCCACCCTCGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAGGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTGCCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCAGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAG
Protein
MVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDVLDIALLKNVTLSLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSIPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRVSLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPRCGKKRTLSAYINQVNQKIIRRATARLASSCL

Summary

EMBL
U07847    AAA17752.1    AB055391    BAB21761.1    AB018558    BAA76304.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    GEBQ01004157    JAT35820.1    KQ971729    KYB24751.1    ABLF02065839    GGMS01006359    MBY75562.1    GBBI01004395    JAC14317.1    KK115285    KFM64681.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GGMR01015412    MBY28031.1    KK119261    KFM75202.1    KK118005    KFM71947.1    GGMR01004661    MBY17280.1    KK113281    KFM59799.1    ABLF02022418    GGMR01012189    MBY24808.1    GALX01005359    JAB63107.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    GFTR01008262    JAW08164.1    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02012584    ABLF02013765    ABLF02024884    ABLF02042518    ABLF02057746    GGMR01000226    MBY12845.1    ACPB03027378    GFTR01008279    JAW08147.1    GGMR01018716    MBY31335.1    ABLF02005245    ABLF02013477    ABLF02047385    ABLF02066435    KB632143    ERL89075.1    ABLF02042385    NEVH01023280    PNF18085.1    ABLF02023911    KK119069    KFM74603.1    ABLF02041767    ABLF02034467    ABLF02015631    ABLF02021986    ABLF02021987    ABLF02021991    GFTR01008256    JAW08170.1    GGFK01009846    MBW43167.1    GGFK01009732    MBW43053.1    GFTR01008261    JAW08165.1    GFXV01000908    MBW12713.1    GFTR01008271    JAW08155.1    GGMR01016297    MBY28916.1    GEDC01029594    JAS07704.1    ABLF02037715    GEZM01084970    JAV60359.1    GBGD01000415    JAC88474.1    GGMR01013409    MBY26028.1    GGMR01012443    MBY25062.1    GEZM01084969    JAV60363.1    GFTR01008251    JAW08175.1    GFTR01008260    JAW08166.1    ABLF02028535    ABLF02028545    GFTR01008257    JAW08169.1    ABLF02003241    ABLF02003242    ABLF02025904    GGFL01005012    MBW69190.1    NEVH01006736    PNF36716.1    NWSH01007753    PCG62823.1    GGFL01004957    MBW69135.1    GGMR01002322    MBY14941.1    GGMR01003864    MBY16483.1    ABLF02037436    ABLF02024246    GECL01003538    JAP02586.1    GGMS01016818    MBY86021.1    GGMS01002992    MBY72195.1    GGMS01014910    MBY84113.1    KK119692    KFM76444.1    GGMS01012398    MBY81601.1    ABLF02007779    ABLF02007782    ABLF02050375    NEVH01022639    PNF18527.1    GGMS01006655    MBY75858.1    LBMM01014024    KMQ85369.1    GBBI01003811    JAC14901.1    GGMS01002786    MBY71989.1    GGMR01016905    MBY29524.1    RSAL01000708    RVE41206.1    NNAY01003095    OXU19992.1    GFTR01008151    JAW08275.1    ABLF02040174    ABLF02040183    ABLF02055266    GBBI01003747    JAC14965.1    GFTR01008169    JAW08257.1    GBBI01004571    JAC14141.1    GGMR01012676    MBY25295.1    GEZM01053022    JAV74219.1    ABLF02012739    ABLF02012741    LBMM01018021    KMQ83899.1    GFTR01008038    JAW08388.1    GFTR01007929    JAW08497.1    GDKW01003730    JAI52865.1    NEVH01011985    PNF31054.1    NEVH01027074    PNF13841.1    GFTR01008246    JAW08180.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF07727   RVT_2
PF03372   Exo_endo_phos
PF14291   DUF4371
PF03564   DUF1759
PF18701   DUF5641
PF00665   rve
PF05380   Peptidase_A17
PF17921   Integrase_H2C2
PF05585   DUF1758
PF04937   DUF659
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR025398   DUF4371       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR037220   BED_dom       
IPR007021   DUF659       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
SSF140996   SSF140996       
Gene 3D

Ontologies

Topology

Length:
470
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
19.66509
Exp number, first 60 AAs:
0.05517
Total prob of N-in:
0.01069
outside
1  -  414
TMhelix
415  -  437
inside
438  -  470
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.000539
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号