SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14531
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.01
 

Sequence

CDS
ATGCGATCTCCGCTCCAGGGGGAGCCTCGTCCTGGTGCGGCGGAGGTTCGAGCGCGGAAACTTCAATCTCGGCGTGCCGTGCTCGAGGCGTGGTCTCGCCGCCTGGCGGACCCCACCTACGGGCGACGAACCGTCGAGGCGATCCGCCCGATCCTCTTGGACTGGGTGAATCGCGACCGAGGACGTCTCACCTTCCGAGCGACGCAGGTGCTCATGGGACACGGCTGTTTCGGTCGCTACCTGCACCTCGTCGCCCGGAGGGAGCCGACACCGAAGTGCCACCATTGCAGTGACTGCAACGAGGACACGGCGGAGCACACGCTCGCGTACTGCTCCGCTTTCGCGGAGCAGCGGCGCGTCCTCGTTGCAAAAATAGGACCGGACTTGTCGCTTCCGACCGTCGTGGTTACGATGCCCGGCAGCGACGAGTCCTGGCAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGACGGAACGGGAGAGAGAGCTCTTCTTCCCTCTCGGCGCCGTGCCGCCGCCGTCGAGCCGGAGGTCGGAGGAGGGCGTATGTCCAGCTCCGGCCCCTATGAGGAGGCAGTCTCCTCCCGGTGATGGTCACGGGGCGACCTAA
Protein
MRSPLQGEPRPGAAEVRARKLQSRRAVLEAWSRRLADPTYGRRTVEAIRPILLDWVNRDRGRLTFRATQVLMGHGCFGRYLHLVARREPTPKCHHCSDCNEDTAEHTLAYCSAFAEQRRVLVAKIGPDLSLPTVVVTMPGSDESWQAMLDFCESTISQKEATERERELFFPLGAVPPPSSRRSEEGVCPAPAPMRRQSPPGDGHGAT

Summary

Cofactor
FAD
Similarity
Belongs to the FBPase class 1 family.
Belongs to the GMC oxidoreductase family.
EMBL
AB126050    BAD86650.1    AB090825    BAC57926.1    LBMM01009501    KMQ88083.1    + More
KZ150386    PZC71062.1    LBMM01016102    KMQ84557.1    KZ150308    PZC71477.1    QOIP01000014    RLU15083.1    KZ149950    PZC76665.1    LBMM01012027    KMQ86470.1    AB078935    BAC06462.1    QOIP01000009    RLU18544.1    ODYU01006757    SOQ48893.1    RSAL01000006    RVE54258.1    AB078931    BAC06456.1    AB078930    BAC06454.1    LBMM01006538    KMQ90523.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    RSAL01003504    RVE40273.1    AB078929    BAC06452.1    ODYU01009945    SOQ54696.1    LBMM01006909    KMQ90209.1    LBMM01003679    KMQ93242.1    RSAL01000109    RVE47213.1    LBMM01008861    KMQ88580.1    RSAL01000481    RVE41577.1    LBMM01006954    KMQ90166.1    ODYU01005282    SOQ45985.1    AY162267    AAO72078.1    LBMM01006996    KMQ90129.1    LBMM01004152    KMQ92762.1    LBMM01004272    KMQ92618.1    LBMM01006657    KMQ90417.1    LBMM01019838    KMQ83439.1    LBMM01019839    KMQ83438.1    ODYU01004136    SOQ43692.1    QOIP01000003    RLU25053.1    GGMR01010769    MBY23388.1    LBMM01006662    KMQ90413.1    ABLF02008325    ABLF02019403    LBMM01002052    KMQ95336.1    LBMM01005634    KMQ91349.1    LBMM01006671    KMQ90407.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF00316   FBPase
PF01421   Reprolysin
PF07776   zf-AD
PF00096   zf-C2H2
PF00732   GMC_oxred_N
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR033391   FBPase_N       
IPR000146   FBPase_class-1       
IPR028343   FBPtase       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR036188   FAD/NAD-bd_sf       
IPR012132   GMC_OxRdtase       
IPR000172   GMC_OxRdtase_N       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF51905   SSF51905       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
207
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0182
Exp number, first 60 AAs:
0
Total prob of N-in:
0.04233
outside
1  -  207
 
 

Population Genetic Test Statistics

Pi
119.056187
Theta
59.808197
Tajima's D
2.01242
CLR
0
CSRT
0.88105594720264
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号