SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14524
Annotation
PREDICTED:_uncharacterized_protein_LOC105842971_[Bombyx_mori]
Transcription factor
Location in the cell
Nuclear   Reliability : 4.128
 

Sequence

CDS
ATGCCGCGTGTTTATAAACCTGATCCTAGAGGGAAAAGATATAGAAAGTACGATGAAAATATTATAAATGAAGCTGTTGCCGCATATGCGAATGGCAAATTCTCTTTAAAGGCCATAGCGGAGAAATATGATATTGATAAATCTGTACTTTATAGACACAGTGTCAAAACTATGAAAAAACAAGGAGGGCAAACTATTTTAACTAACGAGACTGAAGAATGCATGATAAAGTATATCAATATATGTGCAGAATGGGGATGCCCTTTAGATGCTTTAGATTTGAGATACATTGTTAAGACTTATCTTGACCAAGTGGGTCGGACAGTACTCAAATTTAAAAATAATTTACCAGGCCCCGACTTTGTCGCGAGTTTTCTAAAACGTCACAAAAACCAAATTTCCCAAAGATATAGCCAAAACATTAAGAAAAAAAGGGCAGAAGTTTCACCAAACTTGATTAAAGAATATTTCAAAGAGTTAGAAGTGTCATTGGCAGGTATTAATCCGAGTTATATAATTAATTACGATGAAACTAATTTGACCGATGACCCAGGACGCAAAAAAATCATTACTAAACGAGGAACGAAGTACCCAGAGAGGGTAATGAATAGTTCAAAGTCTTCAGTTTCATTGATGATAGCCGCTACAGCTGACGGCACTTTACTCCCGCCGTATGTGGTATACAAGGCTCAAAACTTGTATAACACATGGACTGAAAATGGACCACCAGGAGCAAGGTATAATCGTACGCAATCCGGTTGGTTTGATGCAACTATTTTTGAAGATTGGATTAAATCCATCATTATACCTCACTTCAAAGATAAAGTTGGGAAAAAGTGCCTAATAGGCGATAATCTCTCGTCGCATTTATCGATTGAGACAATAAAACTGTGCCACGAACAAAATATATCGTTCATTTTTTTACCGGCAAATAGTACACACCTCACACAACCTCTTGATGTAGCATTCTTCAGGCCTATGAAGATAGCATGGCGAAACGTAGTATTGAAGTGGAAAAAAACCGATGGGAAAGCCCAATCAACGATTCCAAAGGGATGTTTTCCTAGACTTTTAAATAAATTAATGGAAGAGCTTCGTAACAACAGTAAGGCTAATATAATAGCAGGATTCCGGAAAACAGGAATATACCCGATTAATGAAGAAGAGGTTTTAAGCAGACTACCTGAAGTGCAAAACAATAAAAAGAAAACTGAAATAGAAAAATCCGTTCTAGATTTGCTCAGGGAGATGAGATATGGAACCATGAACATAACCGAACCAAAAAGGAAAAAAAAGTTGATAGTAATACCTGGACGAAGCGTTGGTTCTGAAAGTGAAGACTACATAGAAACAGAACAAGAAGAAAGCCAACAAAAACCAAAAAAGGCAGATCTGAGATCCAAAATAACACAAGACAAAGAAAATACTACAACTAATACTTACGATGGCAAAGAAAACAATAAATATAAGGGAAAAGGTGTAGGGAAAAAAACTAAAACACAAGATCAGAATATTGCTGAAAAAGAAAATAAACAAGAAAACGGACCAGACACTGAAAAAATACTACTTGACGCAATAAATGACTTTGATTTTGTAGCGAACAATTCAATAGAAACAATGCCTATTATGTTGGAAGACATGTTGCTGTGTGAAAATGAAATTGTTTTTCATTACATACAAATAAATGAGATGCAGAATGATACCGGAATAGAAATGACGTATAAACAAAAAAATTCACCGGAAAAAAATAAAAGAAAACTGAAAATTATATCTAATGAAAAGATATCAGATATTACTACGATGAAAAAGGTTACTTTGAATAAGTGCAAAAAAATATATCCCAATTCGCGTCTTAAAATTTTAAAGGATACAATAATTGATAATGTTAATCGTCCTGGTCCAAGCAGTTTACAAACTATCCAAACTCAGCGACCATCGTTTTACAAAAACGATAATGATATTTTGAAAGATTTAATGGATGACGATATATAA
Protein
MPRVYKPDPRGKRYRKYDENIINEAVAAYANGKFSLKAIAEKYDIDKSVLYRHSVKTMKKQGGQTILTNETEECMIKYINICAEWGCPLDALDLRYIVKTYLDQVGRTVLKFKNNLPGPDFVASFLKRHKNQISQRYSQNIKKKRAEVSPNLIKEYFKELEVSLAGINPSYIINYDETNLTDDPGRKKIITKRGTKYPERVMNSSKSSVSLMIAATADGTLLPPYVVYKAQNLYNTWTENGPPGARYNRTQSGWFDATIFEDWIKSIIIPHFKDKVGKKCLIGDNLSSHLSIETIKLCHEQNISFIFLPANSTHLTQPLDVAFFRPMKIAWRNVVLKWKKTDGKAQSTIPKGCFPRLLNKLMEELRNNSKANIIAGFRKTGIYPINEEEVLSRLPEVQNNKKKTEIEKSVLDLLREMRYGTMNITEPKRKKKLIVIPGRSVGSESEDYIETEQEESQQKPKKADLRSKITQDKENTTTNTYDGKENNKYKGKGVGKKTKTQDQNIAEKENKQENGPDTEKILLDAINDFDFVANNSIETMPIMLEDMLLCENEIVFHYIQINEMQNDTGIEMTYKQKNSPEKNKRKLKIISNEKISDITTMKKVTLNKCKKIYPNSRLKILKDTIIDNVNRPGPSSLQTIQTQRPSFYKNDNDILKDLMDDDI

Summary

Pfam
PF03184   DDE_1        + More
PF05225   HTH_psq
PF07530   PRE_C2HC
PF05699   Dimer_Tnp_hAT
Interpro
IPR004875   DDE_SF_endonuclease_dom        + More
IPR007889   HTH_Psq       
IPR009057   Homeobox-like_sf       
IPR008906   HATC_C_dom       
IPR012337   RNaseH-like_sf       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF46689   SSF46689        + More
SSF53098   SSF53098       

Ontologies

Topology

Subcellular location
Nucleus  
Length:
663
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.05193
Exp number, first 60 AAs:
0.01876
Total prob of N-in:
0.00294
outside
1  -  663
 
 

Population Genetic Test Statistics

Pi
324.055607
Theta
189.142865
Tajima's D
2.2485
CLR
17.730492
CSRT
0.915904204789761
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号