SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14523
Annotation
PREDICTED:_uncharacterized_protein_LOC105386002_isoform_X1_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 3.937
 

Sequence

CDS
ATGGATGCTGTGCCAAAGTTCACGGGTGATGACATCACGTACTCTTCTGCGAAGTGGACACAAGATCTCGACGATAATGCCGATATATTTGGGTGGAGCCAGCAGCAGAAACTCATTATAGCGCGACGATGTTTAGCTGGAACAGCAGAATTGTGGCTAAAAAGCGAAAAAACTTTCAGAAGTTACGAAGAACTAAAAGTGGCTTTGATGAAGGAATTCCCTGAGGTGATAAACAGTAAACAAATGCATGAGACAATGAGCAGACGGAAAAAACAACCCAATGAGTCGTTTTATCAATATATGCTCGTAATGAAAGAACTCGGAAAAAGAGCTAAGTTTCCGGATTACGTCGCGATTCAGTATATAATCGACGGAATATCTGACTATGAATCTAACAAGTTGTTATTTTATGGGGTAACGTCGTATTCTGTGCTCAAGGAGAAATTAGTATTATATGAAAGTTTCAAAGAGAAGTCCAAAAAAAGTGTTGATACCATGAGACGAGGTCAGCGAGACGCGGCGGTAATGCCTAGGCAGATTCATCGATGTTACAATTGTGGTGAAAGAGGGCACCTATCTAGTTCCTGCCGCAGAGGTATCAAATGCTTCAAGTGCAACGGGTTCGGGCACAAGGGTACGGAGTGCCGTGCATCACAAGGTATGGAAGCTAAAAAAGCATCAAATAATTATTATGGAGGAGGTGATGAACAAGATCGGCGATCTATGTTTGTTCGACAGCAGGAGGACGACGAGAAGAACGAGAACGAACTATACGAACGTGAGCAATGCGATTTCAATGAACAAGTGAGTGAAATGCCAAATTTTAGTTGTCAACAACTAAATCATATTGTTTCGTCAAATTTATTAAGTGTAAACAAACGTGATTCTGTAAACATGAGTGTAAAATCAGTAAAAGTTGGTAACTATGTGACTAATTGTTTAATTGACACAGGTAGCGACTTAAATTTAATAACTTTTGATTTGTTTACAAAACTAAAATGCGAGTACATACCAGAAAAAATGTTGCTTACTGGGTTAGGAAGTTCTAAAGTATTTTCGATTGGTAAGTTCGACACAGATTTAACTATTGACAGTCACAGATATAGTATTAATTTGTATATTGTACCTACAGGTGGAATACCATATGATGTAATACTGGGTCAACAATTTTTAGTAAATACTATCACAGTTATTGACAAGGGTTTGGTTGAGGTCAGGCCTCCTTGTTATGACATTTCGTATCAAAATGCTATCTGTCTATCTTCCAGTAGCGATGACCAGTGTACAGCGGTTAGGGAAATTATTGACAGTTACACACCTTTGAAGACTAAAGATGCACCTATCAGGCTGAAGATTGTGTTGAAGGATGATGTACCAGTTTCACAAAGACCAAGACGACTAGCCATCACTGAAGAACAGTTAGTTAAGCAGCATGTTGATGCATTGAGCAGAAACGTACTTTTTGTTGATGTCGAGTTACATGCAAGAGTGAAGAAGGCTCAAGCAGATGACGAAAGTTTGAAGGTTATCAGAAAAATCTTAGAAGAAAATGAGTATGAAGATTATTTCCTTGAGAATGGAGTTATTTACAAGGGTATAGAAAAGAAGTTGGTGTTACCTAAGATACTGGATATGGAAATTATTAAGAAAGCACATTGTACAGGACACTTTGGTAAAAAGAAGATAAGGGATATTATAGAGAAAGATTACTTTATTACTAAATTAGATAGCAAAATTGAAAAAGTAATTTCTACATGTGTACCATGTCTATTAGCAAGCAGGAAGTCTGGAAAGAAGGAAGGCAGTGAGTTCCGAGAATATTGTGAAGAAGAAGACATCGAACATGTTACAATCACTACTGGAATACCTCGTGGAAATGGCCAAGTAGAGCGCATGAACAGTATTATTATTTCTGCGTTGACAAAGATGTGTATTGAAGAACCTGGTCACTGGTACAAATATACAAGCAAACTACAACAAGTGATAAACAGCACATACCAGCGGGCAATCTGTACTACACCATTCGAACTGTTAACAGGAGTGAAACTTAAACTGAAAGAAGATTTATCAATTTTAGAATATTTAGAAGAAGAAAATAGATTGCAATTTATGAATAGGAGAGAAGAAGCACGAAGAGAAGCCAAAGCTCAAATTTTAAGAATGCAAGAGGAGAATAGAAAGACTTATAATAAACGACGTAAAGTAGGAGAAATGTACAAGGTTGGAGATCTTGTAGCTATTCAAAGGACACAATTTGGGAACGCCCTAAAATTGAAACCTAAATTTTATGGACCATATCGCATCACTAGGGAAATGGGGAAAGGTCGATATGAGGTCGAAAAAATAGACAGAAGCAAAGATGGGCCAGTACGAACTACATCAGCATTAGATTTCATGAAGAGGTGGCCTTGA
Protein
MDAVPKFTGDDITYSSAKWTQDLDDNADIFGWSQQQKLIIARRCLAGTAELWLKSEKTFRSYEELKVALMKEFPEVINSKQMHETMSRRKKQPNESFYQYMLVMKELGKRAKFPDYVAIQYIIDGISDYESNKLLFYGVTSYSVLKEKLVLYESFKEKSKKSVDTMRRGQRDAAVMPRQIHRCYNCGERGHLSSSCRRGIKCFKCNGFGHKGTECRASQGMEAKKASNNYYGGGDEQDRRSMFVRQQEDDEKNENELYEREQCDFNEQVSEMPNFSCQQLNHIVSSNLLSVNKRDSVNMSVKSVKVGNYVTNCLIDTGSDLNLITFDLFTKLKCEYIPEKMLLTGLGSSKVFSIGKFDTDLTIDSHRYSINLYIVPTGGIPYDVILGQQFLVNTITVIDKGLVEVRPPCYDISYQNAICLSSSSDDQCTAVREIIDSYTPLKTKDAPIRLKIVLKDDVPVSQRPRRLAITEEQLVKQHVDALSRNVLFVDVELHARVKKAQADDESLKVIRKILEENEYEDYFLENGVIYKGIEKKLVLPKILDMEIIKKAHCTGHFGKKKIRDIIEKDYFITKLDSKIEKVISTCVPCLLASRKSGKKEGSEFREYCEEEDIEHVTITTGIPRGNGQVERMNSIIISALTKMCIEEPGHWYKYTSKLQQVINSTYQRAICTTPFELLTGVKLKLKEDLSILEYLEEENRLQFMNRREEARREAKAQILRMQEENRKTYNKRRKVGEMYKVGDLVAIQRTQFGNALKLKPKFYGPYRITREMGKGRYEVEKIDRSKDGPVRTTSALDFMKRWP

Summary

Pfam
PF00077   RVP        + More
PF00098   zf-CCHC
PF00665   rve
PF17921   Integrase_H2C2
Interpro
IPR001995   Peptidase_A2_cat        + More
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR018061   Retropepsins       
IPR036397   RNaseH_sf       
IPR003034   SAP_dom       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR041588   Integrase_H2C2       
SUPFAM
SSF57756   SSF57756        + More
SSF50630   SSF50630       
SSF53098   SSF53098       
Gene 3D
PDB
3DLR     E-value=6.38419e-08,     Score=139

Ontologies

Topology

Length:
803
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00829
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00041
outside
1  -  803
 
 

Population Genetic Test Statistics

Pi
252.347065
Theta
145.771216
Tajima's D
2.980797
CLR
0.00598
CSRT
0.977501124943753
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号