SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14514
Annotation
PREDICTED:_uncharacterized_protein_LOC106141703_[Amyelois_transitella]
Location in the cell
Mitochondrial   Reliability : 1.51 Nuclear   Reliability : 1.958
 

Sequence

CDS
ATGCCTTTAACTAGAAATCAAGATCGCCAGCAACGTCGCGAAGACGACGTTATTCCTGCTGCAGATGCAAATGCCAACGAAAATCACGAGGAGCATGATAGCCCCCATGATCGCCCCCACGCCGAATCACGTAGCAACAATTCTACGTTCAACCTGGATGATGTTTCAGCGTTGATGGCCTCGCTGCAACGTTCGCAGGCCGAAACATTTAAGAACATTATGTCGTACGTGATGGAACAAAGATCGTCGACTCCGGCACCTCCGCCGATGCCCCCAGTGAACGTAGATGGTACCTTGGCGCGTTGCAGAGCTTCTTTCAGCGGTGCACCTGGTGAATCTGTTGAGGCCTTTATAGATGCAATTGAAAGCTATACAGAATGCGTTCAAGTATCTGACGCTAACATCATACGAGGCCTAGCCATGCTTTTGTCTGCTGACGCAGCTACGTGGTGGCTAGGATTAAAGCATCACATCTCCACTTGGAACGAAGCCAAAGAAAATTTAATATATGCATATGGCACCCGCCTTCCACCACATAGAATATATTTGGAAATATTTGCTTCCCCGCAGGATAACGAAAACACAGACAAGTTTGTTGCTCGTATTCGTGCGCTTATGGCAAAGCTACCGCGGGATGATATTACTGAAAAAGTACAACTTGATATGATATACGGGTTGCTTCATAATAGAATACGCACAAGATTGCGCCGTGAAGAAATCACATCTTTCAATTCATTATTAAACCATGCTCGGAATATAGAAGATTCGATAGAGGAGACTCAATCGAGACCAGTGTCGTCCACTAGTGGTGTGCGTTCGATCCGTGCCCAGCCGGCCCCGGCTGCGAGTCGGCCTGAACCGTGCGCCGCTCGTGCGAGTGCGCCGGCGCCGCGCGCGCGCTTTCCTAACTCCGCCGCGGCCGTCGTGCCCGCCACCGCGGTGCCTGTCGCTGTCGCCCAGCCTACCGTTGCCACGCCTGCCGCTGCTGTGCCAGGTTCTGCAGAGCAATTCGTGACCACGAAGAAACAGCGTCCAGTGTGCTCCTACTGCAAACGGTTTGGACATGCACGGGAACAGTGCCGTAAGTTAAACAACCGAGCGTCCGTGTACGACCGTGAGAGTGATGATAGGTATTTGCATTTACGGCCTATTTTCAAAATTCAAGTTCTCGGTAAACAGGGTACTGCACTTATAGATACAGCAGCTAAGCATTGTATTGCTGGTCACACGCTGTATGCTCTCCTTCTGCAAAAGGGTCACCCTCTTACTCCCTCCACTAGGCGAGTCAAACTTGCTGATGGGCATGTTCGGAATATGGATGTATTGACAACCATATTACCAGTGAGGTTAGAACACATAGTGATTGATATTCCATTTATAATCTTCCCTGATTCTAATGATAATGAAACTTTACTGGGTATTGATTTTATTAATGCTGCCAAAGTTATTATTGATTTTCATCGTCATGAATGGTATTTTAGTACTGATGCTAAGGTGCATTATAAATTACTTTTTGAACCTATGTCTCGTGGTGTGTGCATAGCTTCTACTAACATGCTTCGGGATGATGAAGGTATGCACTTGCAATCAGCTGAGCGCCAAGCATTGTCTGAGTTCCTTATTCGGCATGAAAGTATTTTTACAGCAGGGGGAGGTCCGACACCATTCATAGAACATTGCATAGACACCGGAGATCACCCCCCGATAGCTGTGCCGCCCTATCGCCTTAACCCTTCCAAGAAGGAGACGATGAAGAATGAAATAGAGAAGATGCTGGCAGATGACATCATTGAAGAGTGCGAATCCGCCTGGTGCTCTCCTGCATTGATGATACCGAAGTCCAATGGTAATGTAAGATTCTGCGTGGATTACAGGCGCTTAAATGAAGTAACCAAATCGGATACTTACCCACTCCCACGCATTGATGATCTTCTCCAGAGTACGAAGAAGAATTGTTACATGACCACAATAGACCTTCGTTCTTCATATTGGCAAGTGATGGTCCGAGAAGCAGACAGAGACAAAACAGCTTTTGTCTGTCCCCTAGGCACTTATCGTTTTAAAAGAATGCCGTTCGGCTTGAAGAATGCGCCGGCGACTTTCCAAAGGCTTATTGATCGTCTACGCTCCTGTGCTGCTTTGAAGGATGTTACAGTACTTGCTTATCTAGACGATTTGTTAATTATTTCAGAAGGATTCCAGCAACACCTACAAGACCTGGAAGCTGTTTTTAGACGTTTGTCTGAATTTAAACTTCACGTAAACAGAGAGAAGTGCACTTTTGCCAAAGAAAGGGTCCGTTATCTGGGCCACGTCATCACTCCAGACGGTGTGTCTCCTGACCCTGAGAAGGTCAGTGCTGTCCTTAATATGCTGGAACCATCTAACCTAAAACATTTAAGAACTTTTCTCCAAACATGCTCTTGGTTCAGGAAGTTTATTCCAAACTTTTCAAAGATAGCAGAACCGCTTACTCGACTGACCAAGAAGAATTACACATGGATCTGGGGACCTGAACAAACACAGGCATTCAAAGAATTGAAGCGTCTGCTGACCACGGCGCCCGTACTTGTTCAAGCGAATTTTAAACAACCCTTAGTACTGCGTACCGACGCGAGCAACTATGCACTTGGCGCAGTTTTAGCTCAAGGGGAAGGCAAGGACGAAAGGCCTATCGAGTATGCTAGCCGCCTACTCACCGCAGCGGAGCGCAACTACTCTACTACAGAACGGGAAGCGCTTGCTGTAGTCTGGGCCGTGGAGCGTTTCAGGCCATACCTCGACGGCCAACCAATTATTATAGGCAGTGACCACCAACCCTTGCGTTGGTTGCTTTCTTTAAAGTCTCCTGCTGGTAGGTTGGTCCGTTGGGCGCTTAAACTCCAAGAATTTGACATCAGATTCGAGTACACCCCAGGAAAAGCTAACGTTGTCGCTGACACGTTAAGTAGACCGATCTGTTCCAACGAAACACAAAATAACTGCGGCATCTGTTCTGTCATTTGCGACCTGCCCACCAAGTCACCTACCCAGTTACGTCAAGACCAGTTGACTGATCCGGAAATACAGAAGATCGTCACAGAACTGGAAGGAGTGGATGAACTTGCTGCTAAAAGATGGTCAGAAAGAGGATTTCTAATGGAACAAGGTGTTTTATATCGACTTAATCCGGATTCTGATGCCGAGGCCCCACAATTAGTCATTCCTGCCCATCAAGTGACCGACGTTCTCAAAGAGCTTCACGATGCCCCTACCGCTGGACATGCAGGAATTGACCGGACTTACCAACAAGTCTCACGTCTGTTCTACTTCACAGGAATGAGAAGAATCATAACCGACTATGTAAAGGCATGTGTCCATTGTCAACGCTATAAGGCTGCTAATACCAAGCCTCCAGGTCTATTGCAGACGCCGGTGATGAACCAGCGCAACGAGGTCTTGGCAGTTGATCTTTTCGGCCCGTTGCCACCTGGAAAACAGGGGGAGCGTTGGATCTTGCTAATAGAAGATACTGCTACGAGGTGGACAGAACTTTTCCCATTGAAGGAAGCTACTGCTGAGGCGTGTGCACATGTCCTCATAGAGGAGTATTTTATGAGATTTGGTCTTCCACGCCGACTAGTTTCTGATAATGGCGTACAATTTATTTCGGCAGTCATGCGTCAATGCATGTCCATCCTGGGGATAAAGCAAAACCTTATCCCTCTCTATCACCCAGAAGCAAACCCTGCCGAACGTAAAAACAGAGATCTTAAGACTTTATTAGCACAACTCGTGGAATGTGACCACACTTCCTGGCCAAACATGTTACCAGTGATTCGATTCGCTCTTAATAACGCTAAATGTCGCACCACAGGTATGTCACCTGCTTACTTGTCATTTGGCAGAGAGATGAGGTCCCCCACAGAAGTCACTCATGACCTTCGTGCTGTTCTAGACAAAGATAACTTCAAGATAAAGCTAAAGGGTATGCTGATCGTTCGAGACGGCCCATTGAAACATTCAACGAAGGTGACATGGTTCTCATCAAATCACACGTCCTCAGTCAGCCCTACTACTTACCACGTCGCGCATGTTGACAAACCTGATGAAGTTTTAGGGAAATATCATGTGAACGATCTCACTCTATACCGTGAGAATCAGAGTGATGCTCTTCCGCGGCCGGTGATGCCTAAAAAGAAACGTGGTCGTCCCCCAAATAATGTTAAAACAGATTCTCGAGTTCCAGGGCATATGACGACACGGCATGCTGAACCATGTGCTGAAGCTCCACGTCTTTCTCCCGCAGCTGGTGGGAGATTGATGTTAACCTATCATAAAGGTCTGACCATGATGTGTGTGTGCAAGATGTAA
Protein
MPLTRNQDRQQRREDDVIPAADANANENHEEHDSPHDRPHAESRSNNSTFNLDDVSALMASLQRSQAETFKNIMSYVMEQRSSTPAPPPMPPVNVDGTLARCRASFSGAPGESVEAFIDAIESYTECVQVSDANIIRGLAMLLSADAATWWLGLKHHISTWNEAKENLIYAYGTRLPPHRIYLEIFASPQDNENTDKFVARIRALMAKLPRDDITEKVQLDMIYGLLHNRIRTRLRREEITSFNSLLNHARNIEDSIEETQSRPVSSTSGVRSIRAQPAPAASRPEPCAARASAPAPRARFPNSAAAVVPATAVPVAVAQPTVATPAAAVPGSAEQFVTTKKQRPVCSYCKRFGHAREQCRKLNNRASVYDRESDDRYLHLRPIFKIQVLGKQGTALIDTAAKHCIAGHTLYALLLQKGHPLTPSTRRVKLADGHVRNMDVLTTILPVRLEHIVIDIPFIIFPDSNDNETLLGIDFINAAKVIIDFHRHEWYFSTDAKVHYKLLFEPMSRGVCIASTNMLRDDEGMHLQSAERQALSEFLIRHESIFTAGGGPTPFIEHCIDTGDHPPIAVPPYRLNPSKKETMKNEIEKMLADDIIEECESAWCSPALMIPKSNGNVRFCVDYRRLNEVTKSDTYPLPRIDDLLQSTKKNCYMTTIDLRSSYWQVMVREADRDKTAFVCPLGTYRFKRMPFGLKNAPATFQRLIDRLRSCAALKDVTVLAYLDDLLIISEGFQQHLQDLEAVFRRLSEFKLHVNREKCTFAKERVRYLGHVITPDGVSPDPEKVSAVLNMLEPSNLKHLRTFLQTCSWFRKFIPNFSKIAEPLTRLTKKNYTWIWGPEQTQAFKELKRLLTTAPVLVQANFKQPLVLRTDASNYALGAVLAQGEGKDERPIEYASRLLTAAERNYSTTEREALAVVWAVERFRPYLDGQPIIIGSDHQPLRWLLSLKSPAGRLVRWALKLQEFDIRFEYTPGKANVVADTLSRPICSNETQNNCGICSVICDLPTKSPTQLRQDQLTDPEIQKIVTELEGVDELAAKRWSERGFLMEQGVLYRLNPDSDAEAPQLVIPAHQVTDVLKELHDAPTAGHAGIDRTYQQVSRLFYFTGMRRIITDYVKACVHCQRYKAANTKPPGLLQTPVMNQRNEVLAVDLFGPLPPGKQGERWILLIEDTATRWTELFPLKEATAEACAHVLIEEYFMRFGLPRRLVSDNGVQFISAVMRQCMSILGIKQNLIPLYHPEANPAERKNRDLKTLLAQLVECDHTSWPNMLPVIRFALNNAKCRTTGMSPAYLSFGREMRSPTEVTHDLRAVLDKDNFKIKLKGMLIVRDGPLKHSTKVTWFSSNHTSSVSPTTYHVAHVDKPDEVLGKYHVNDLTLYRENQSDALPRPVMPKKKRGRPPNNVKTDSRVPGHMTTRHAEPCAEAPRLSPAAGGRLMLTYHKGLTMMCVCKM

Summary

Pfam
PF17921   Integrase_H2C2        + More
PF00665   rve
PF17917   RT_RNaseH
PF00078   RVT_1
PF17919   RT_RNaseH_2
Interpro
IPR012337   RNaseH-like_sf        + More
IPR001584   Integrase_cat-core       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR041373   RT_RNaseH       
IPR000477   RT_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR041577   RT_RNaseH_2       
IPR003034   SAP_dom       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
Gene 3D
PDB
4OL8     E-value=1.48666e-72,     Score=699

Ontologies

Topology

Length:
1450
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.14424
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00710
outside
1  -  1450
 
 

Population Genetic Test Statistics

Pi
335.636014
Theta
187.727839
Tajima's D
2.467364
CLR
0
CSRT
0.943802809859507
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号