SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14509
Pre Gene Modal
BGIBMGA014302
Annotation
putative_RNA-directed_DNA_polymerase_from_transposon_BS_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 2.562
 

Sequence

CDS
ATGCATTTCAGACTTCAATCGAGGCTCATTGAAGAGTTGCCGCCCGGTCGCCCACAGGAGAACCCACGGCACCCTAAGAGGGCAAGGGTGCTCCCTCCTAAGGTCGGGAAACACCCAGGATATTTACAATGTGGGCCTGGGAGTAGCCGGGCCAGCACCTCGGTCATGGAGTGGCCGGGGACTAGCGGGGCCAGCACCCCGGTCATGGAGTGGCCGGGGACTAGCGGGGCCAGCACCTTGGCCACCGAACGGTCCGGGCCTAGCGGGGCCAGCACCTCGGCCAACGAGCGGCCCGGGCCTAGCGGGGCCAGCACCTCTGCCACCGAGCGGCCCGGGCCTAGCGGAGCCAGCACCTCGGCCACCGAGCGGCCTGTTATCCCTTCGTCCTCTCGACCTCCTCGTCTTCTTCGCGAAGACGAAATTATAGCACTGCTGAATTACGGCAGCGAAGAGGACTCTGAGGGAGAGGAGGAAGAAATTCTGCAGCCGTCGCTGGTTCCCCGGGCGACCAGGATGTGGCTGGACGAAGCGGATGAGGAAGTTGAAGAGCAAGCGGAGAGGCTTAATATTAATTTGGAGTGGCCTCAACCTCCTCAACCTCTTCGTCCATCCGCCATCTGCTCCAGTGGACGTCTCACCGACGTCCACATTAGAACCTCGCTAGCCCGAGAACTTAAGACCCGCGGCTTTGACTGTGTGGGCACACTGCGGACTAACCGACAATTTGTGCCGTACGAATTGACGTCCCTTACAAAAAAGGATATGACAGTCGGTCAAGTGACGGGATGCACCTCGGGAAATGTGGATCTTTTGGTGTGGAAAGATAAAAACCGGGTGGCTTTTATTTCCACATACCATGGTCTCGCATCTGTTAGAAATCCATACTTATTGTTGTCCGCATATAACCGCCAACTGTTTGGTACTGCCCGTCAAAAGGGAAAGGACAAGGGCTGGAAGTATGTCTGGACCAAGGACGGACGAATTTACATTCGTCGTGGTGATGGTACTCCTGCGCTTAGAATCAGAGTTCAGGCCGACTTGAAGAAGCATTTTGGCCCAGATATAGAATGTACTGTATTGCAGATCTTGCAACAACTGAAGTCTGATGCTCTGGGTGTTGATGATATTTCCCTTAAAATGTTGTGTATGACATTGCCCTACAGTCTTACTTCTGTCACCAATTTTGTTAATATGTCAATTAATACATCGATATTTCCTTACACTTGGAAGACTGCTGTGGTTCGTCCTGTTCCTAAGAAACCTAATGCCATGACACTCAGTGACCTCCGACCCATCAGTATATTGCCCTGCTTGTCTAAAATTCTAGAGAAAGTAGTATCTTCACAGCTGACGGACTATCTTGAGAAACATAACATATTGCCTGAGTATCAGTCCGGATTCCGGAGATCGCGTGGTACTGCAACTGCTCTCTTAGATGTGACGGATAGTATCCTCGCTGCACAGGATCGGGGTATGTGTACGGTTCTGGTACTTCTGGACTTCTCTCGAGCATTCGACAGCTTGAACATTGACCTTCTTCTTGCCAAATTGAGTTTCTACGGCTTAAGTGCGGATACCATTCGTTGGTTCTCAAGTTATCTGACTGAACGATCGCAATTGGTGGAAATTCGTCGCGGTGAGGGTAATGTTCGATCCAACATGGCTAACGTCATTAATGGTGTACCACAGGGTTCGATCCTGGGCCCTTTGCTATTTATCCTTTACAGCGCAGATATTGTTGGTCATATCAATCATTGTCAGTACCATATATATGCTGATGACATTCAACTGTACATCTCTTTTAAGATGTCCGAGTTTACAATGGCCATTGAGAAACTTACAGGGGACCTAAATAGAGTGGCGAATTGGTCGGAACAGAACTCACTCTTCTTAAATCCCAGCAAGACTAAATATATTGTGTTTGGAAATGAATCTCGATTGTCTAAGCTTCCATCACAACCTTTCAATGGGTTAAATATTCGAAATGACCCCATTGAGAGAGTATATGAGGTGCGTAACTTGGGCCTACTGATGGACGCAGAGAGTACAGAATGCATGCATGAGATTTTGCTTTAG
Protein
MHFRLQSRLIEELPPGRPQENPRHPKRARVLPPKVGKHPGYLQCGPGSSRASTSVMEWPGTSGASTPVMEWPGTSGASTLATERSGPSGASTSANERPGPSGASTSATERPGPSGASTSATERPVIPSSSRPPRLLREDEIIALLNYGSEEDSEGEEEEILQPSLVPRATRMWLDEADEEVEEQAERLNINLEWPQPPQPLRPSAICSSGRLTDVHIRTSLARELKTRGFDCVGTLRTNRQFVPYELTSLTKKDMTVGQVTGCTSGNVDLLVWKDKNRVAFISTYHGLASVRNPYLLLSAYNRQLFGTARQKGKDKGWKYVWTKDGRIYIRRGDGTPALRIRVQADLKKHFGPDIECTVLQILQQLKSDALGVDDISLKMLCMTLPYSLTSVTNFVNMSINTSIFPYTWKTAVVRPVPKKPNAMTLSDLRPISILPCLSKILEKVVSSQLTDYLEKHNILPEYQSGFRRSRGTATALLDVTDSILAAQDRGMCTVLVLLDFSRAFDSLNIDLLLAKLSFYGLSADTIRWFSSYLTERSQLVEIRRGEGNVRSNMANVINGVPQGSILGPLLFILYSADIVGHINHCQYHIYADDIQLYISFKMSEFTMAIEKLTGDLNRVANWSEQNSLFLNPSKTKYIVFGNESRLSKLPSQPFNGLNIRNDPIERVYEVRNLGLLMDAESTECMHEILL

Summary

Uniprot
ProteinModelPortal
PDB
1DEQ     E-value=0.0129683,     Score=93

Ontologies

GO

Topology

Length:
691
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.27387
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00042
outside
1  -  691
 
 

Population Genetic Test Statistics

Pi
2.737684
Theta
161.179816
Tajima's D
0.851493
CLR
0.412888
CSRT
0.614319284035798
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号