SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14507
Annotation
PREDICTED:_uncharacterized_protein_LOC106720812_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 2.129
 

Sequence

CDS
ATGATCACCCGCAGTAAAAGTAAAATCATGCCGACAAACCCTGCGACTAGTACTGGTTTGCAAGTTAATATTATACAACCTAGTACTTCCCAACATGTAGACAGCATTGCTCCGAGTGAGACGTCTAAGTCAAAATCATCACGCTCGTCATCCACAATTAAGGCTCAAAAGGCCGCCGTAGAGGCCCTCGCCCTGCGCCGACGTCTTGAGCACGAGCAGGAGCTGGCTGAACGTGAGAGGCAACGTGAAAGTCGACTGGCAGCACTCCGTCAGCAGGTAGAGGAGGGCGAACTGAAGGCCGAACTTGCCGCTCTCGACGCGGAAGCCGCGGCAAGTCACAGCAGTCGCAGTGGTTCTGCCAGGGTAAGCGTAGAAAGAACAGAAAGATGGGTACAAAGTTTAGAACAGCCAGTTTGCGTTGGCGAAAATACAGTTAATAGAGGCATTCCCGCAGTAGGGCGAGAGCAAGTAGTGGTTCCGCCTCCCGGCCACCAGGCACCTCTGCCGGCCACTGGGTCAACTGCATCCCCTGTTAACCGTTTTGTTCATCAGAAACAACTTTTAAACGTCACTAAAGCGTCCGAGGCGGCCGTACTTACGCGACCGCTCATTTCCACGGAGGTTGATCAGAGTAGTCTGCTTCAGGCTGTTGCTGACACTGCAGCTGCGGCCAAGGCGCTTGCTACTTCGCACCGTCATAAACATAAGATCGAATTGTTTCCTTTCGACGGAGACGCCTTAACATGGCTACATTTCAAACGTATTTTTGATTTAACCAAAAACAATTTTTCAAATATTGAAAATATTAGTCGGTTACAAAATGCACTTCGCGGCGCGGCCCGAGATGCAGTCGCGTCACTGTTGCTGGCTACAGACAACCCGAACGACATTATAAGAGCTCTGGAGGAGAACTTCGCTCGCCCGGAAATTATAGTATTTAAGGAAGTCTCCGCTCTTAAAAATCTACCACGTTTGGGAAATGACTTGAAAGAGTTAATTACGATAACGAATAAGGTACGTAATTCTATATCTTCTTTTAAAATACTGAATCAAATTGAGTACTTGCATTCTCCAGAACTATTTCACGCCGTCTTAGGAAAATTAAACCCGGTTACTAAAGTAAGATGGACGGACTTTGCTATGCAAGATACTACAGGGCGTCCTAAATTAGAAATTATGTCCGATTTTTTGAGGCGCGAGTTAGATCAACTTATTCGGTTCGGTTTATCACCGGAATCTTGCTCGATCCAACATTCACCACAAAACACTCATCTAAACAAACCGTATAAACGGGAAAATATTCACATAGTTACACACTCTAAACTAAATTCTAAGGCGGCGTCTACACAAAAGCTTGAATGCGCGTTTTGCAAAAAAGATCACAATATTAAGTCATGTTCTGAGTTCAAAGCCTTATCTGTTGATGAAAGGTGGGTCTGGCTGCGTGAGGTAAAAGCGTGTTATAAATGTCTTAGGCGTAGTTCACATCAGTGGAAAACATGTAAAGTTAACCCTTGTGGTGTTGATGGGTGTCTAATACGTCATCACCCGTTAATGCATGGTAAAGAACCTGCCTCTTCTGTCAATACTATGTTCGACACGCAATCCACCGAAAATGATCATACGACTAAGCACCACGAACCTGCATCTGTCGAAAAGGTAATAGTTTCTACCACTTCTACAGGTGTTCAAGAACCCAGCTCCATCTTAACTCTGTGCCCGCGTGTATTTCTGAAAATCTTACCCGTTACTGTCTCTGGTCCCTCAGGAAGTTGCAATGTTTACGCACTTCTCGATGACGGTAGCACTGCTACGCTCATTGACTCAAGTATTGCTACTCAAATCGGTGCGACAGGGCCTCACCAGAAAATAACGGTTAATGGTATAGGCGGTCTCAGTAGAAACGCTACGATATCGTATGTAGATTTTCACATTAAGGGTAGGCACACACGAGACACATTTTTAGTGAAAAATGCGAGAGCTATGGAGTCTTTGTCTCTGCGTCCTCAAACGATTAGGCAGGAAACTATTGCTTCTTTCGCACATTTAGCGAATTTACCTTGCAACGTAACTTATGAAGATGCTACACCAACAGTTTTAATTGGTGCAGAGCATTGGCATTTGTCAATCAGCAGCGAGGTACGGTGTGGTGGTAAGAATGAACCCGTTGCCTGTTTAACTGCCTTAGGCTGGGTGCTTTATGGAATCGCGTCCAGTAAAACTAAATCAGTGGAGTTTGTTAATCACGGTGTGTGTATCGAACCTTCCGATGAGGAGAAATTAGACTCTTTTATTAGGGAACAATACAAAATTGATTCGTTAGGTATTTCTAAAAAAGAAACTCTACATTCTAAGTCAGATAAACGTGCAGTCGAGATTTTAGAAAAAACTGCTAGACGTCTCCCCACTTCTGGTCGATTTGAGGTGGGTTTGCCGTGGCGTGACGATATACAACGCATTCCCGACAGCTACCCTCAAGCCATGTCACGATTTTTAAGTCTAGAAAGGCGCATGGCTAAAGATGCTGACTTTGCAAAAGCATATAACGTGTTCATTTCAAACATGATCGCTAAAGGCTATGCAGAAGAATGTGCTCCCGAGTCATACTACGCCAACCACATTAAAGATAAACAATCTTCTTTTATGAGGCTCTATTTACCCCATTTTGGCGTGTATCACCCTCAGAAACGTAAGCTTCGTGTAGTTCACGACGCCGCAGCCACGAATGCGGGCGTCAGCCTAAACTCTTTGTTGCTACCTGGTCCAGACCTGCTTCAGTCCTTGTTAGGTATTTTACTTCGGTTTTGCGAGGGCCGTATTGCTCTCACAGCTGATATCCGGGAAATGTTCCCTCAAGTAAGGATCAGAGAGCAAGATAGGGACGCCCTCCGGTTTCTCTGGAGGTCAAGCAGAGACCAACCTATAAAGGAGTTTAGGATGACAGCCATCATTTTCGGTGCGTGCTGCAGTCCATTTATAGCGCAATTTATTAAAAATAAAAACGCTCGTGAGCACGAAAGTTTATTTCCTAAAGCAGCTCATGCTATTTTGTACAATCATTATATGGACGATTATATTGACTCTCTCGATGACATTCAAGAGGCAGCACAACTGGCGGCAGATATTGTTGCCGTTCACAATGATGCCTACTTCGAGATGCGGGGCTGGATTTCCAACGATCCATCAGCGCTAAAATTTATTCCTGATGATCTTAGGGCCACTCAACCGTCGTTGGAAATCAACCTTGGCAGCTGCTCTGCAAACAATATTAGAGCGTTGGGAGTCGAGAGCTTTTCCATAGAATTTCTTCATATCCTGAACTCGAAGCCTATTCCTCCGAACAGTCGTCTCAGAAAACTGTCACCCGCTTTGGGAGAGGACAAATTACTGCGGTTAGCCGGAAGAATTAAAGCCGCAGAAGGCATTGACCCTGACACACGCTTCCCCATCCTTCTTGACGGTCGTCACCCAATTATCTTACCTACTGCCTTGAACGATCACGATTTGGTCAGCCGTTCCGAATGGAGGAAAGCATTGAGGCTAGCGGATCATTTTTGGTCGCGTTGGATGCGCGAGGTTCTTCCGACCCTACAACCACGTGAGCAGTCAAGAGGCAACCGCAGTTCAACAGCTTTTCAAGAGGGTGACGTAGTAATTATTGCTGACTTCAACTTGCCCCGCGGAATATGGCCACGAGGACGTGTTGCGAAAGTGTACCCTGGGAAAGATGGCGTGATAAGGGTAGTGGACGTTGCAACAGCAGGGGGAATGCTACGCCGACCCGTACGAAAGCTGGTTAGGCTCTCCACCTAA
Protein
MITRSKSKIMPTNPATSTGLQVNIIQPSTSQHVDSIAPSETSKSKSSRSSSTIKAQKAAVEALALRRRLEHEQELAERERQRESRLAALRQQVEEGELKAELAALDAEAAASHSSRSGSARVSVERTERWVQSLEQPVCVGENTVNRGIPAVGREQVVVPPPGHQAPLPATGSTASPVNRFVHQKQLLNVTKASEAAVLTRPLISTEVDQSSLLQAVADTAAAAKALATSHRHKHKIELFPFDGDALTWLHFKRIFDLTKNNFSNIENISRLQNALRGAARDAVASLLLATDNPNDIIRALEENFARPEIIVFKEVSALKNLPRLGNDLKELITITNKVRNSISSFKILNQIEYLHSPELFHAVLGKLNPVTKVRWTDFAMQDTTGRPKLEIMSDFLRRELDQLIRFGLSPESCSIQHSPQNTHLNKPYKRENIHIVTHSKLNSKAASTQKLECAFCKKDHNIKSCSEFKALSVDERWVWLREVKACYKCLRRSSHQWKTCKVNPCGVDGCLIRHHPLMHGKEPASSVNTMFDTQSTENDHTTKHHEPASVEKVIVSTTSTGVQEPSSILTLCPRVFLKILPVTVSGPSGSCNVYALLDDGSTATLIDSSIATQIGATGPHQKITVNGIGGLSRNATISYVDFHIKGRHTRDTFLVKNARAMESLSLRPQTIRQETIASFAHLANLPCNVTYEDATPTVLIGAEHWHLSISSEVRCGGKNEPVACLTALGWVLYGIASSKTKSVEFVNHGVCIEPSDEEKLDSFIREQYKIDSLGISKKETLHSKSDKRAVEILEKTARRLPTSGRFEVGLPWRDDIQRIPDSYPQAMSRFLSLERRMAKDADFAKAYNVFISNMIAKGYAEECAPESYYANHIKDKQSSFMRLYLPHFGVYHPQKRKLRVVHDAAATNAGVSLNSLLLPGPDLLQSLLGILLRFCEGRIALTADIREMFPQVRIREQDRDALRFLWRSSRDQPIKEFRMTAIIFGACCSPFIAQFIKNKNAREHESLFPKAAHAILYNHYMDDYIDSLDDIQEAAQLAADIVAVHNDAYFEMRGWISNDPSALKFIPDDLRATQPSLEINLGSCSANNIRALGVESFSIEFLHILNSKPIPPNSRLRKLSPALGEDKLLRLAGRIKAAEGIDPDTRFPILLDGRHPIILPTALNDHDLVSRSEWRKALRLADHFWSRWMREVLPTLQPREQSRGNRSSTAFQEGDVVIIADFNLPRGIWPRGRVAKVYPGKDGVIRVVDVATAGGMLRRPVRKLVRLST

Summary

Pfam
PF03564   DUF1759        + More
PF05380   Peptidase_A17
PF00665   rve
PF18701   DUF5641
PF01565   FAD_binding_4
PF17921   Integrase_H2C2
PF09129   Chol_subst-bind
PF05585   DUF1758
Interpro
IPR008042   Retrotrans_Pao        + More
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR016164   FAD-linked_Oxase-like_C       
IPR041588   Integrase_H2C2       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR008737   Peptidase_asp_put       
IPR002999   Tudor       
IPR019786   Zinc_finger_PHD-type_CS       
IPR019787   Znf_PHD-finger       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR011011   Znf_FYVE_PHD       
SUPFAM
SSF53098   SSF53098        + More
SSF56176   SSF56176       
SSF55103   SSF55103       
SSF57903   SSF57903       

Ontologies

Topology

Length:
1270
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.06906
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1270
 
 

Population Genetic Test Statistics

Pi
444.716092
Theta
215.423581
Tajima's D
3.985758
CLR
0.593893
CSRT
0.99910004499775
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号