SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14492
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.145 Nuclear   Reliability : 1.703
 

Sequence

CDS
ATGGCCATACGGCGTCAGGACACATCCGCTTCTCCGTCAGAACGATCGGCTCTCAGCAAGCAGATAACGAAATTGGTTCGACGTGACCTTCGACGCTCCACTACTCGAAGAATTGAAAGAGCCATTGAACAGAACCGTGGGTCAAAGGTATTTAACCAGCAGCTTAAGAGAAGTCGTTTATCGAAACTCAAGACCTCCGATGGTAACGTCATCATGTCGCAGACGGGGATTCTCGCTGAGATTGAAAAATATTACGGTCAGCTGTACGAGTCCTGCACCACCCGTTCTGTACAGAACTCAGAACAGAACGATTGTAGAGCCCCACTCACGCGCCATTTCACCGATGAGCTGCCGGACGTCAGTGTGGACGAAATAAGATTGGCTCTGAGACAACTCAAGAATGGAAAAGCCCCCGGAGATGATGGTATAACAACTGAGCTATTGAAAGCAGGAGGAACACCTCTCTTAGTAGAGCTACAGAAGCTTTTCAGCCACGTCATCCACCGCGGGAGAACTCCGAAGGCGTGGAACAACAGTATTGTGATACTTTTTTTCAAAAAAGGAGACAAAACTCTTTTAAAGAACTACAGACCAATCTCCCTCCTGAACCACGTCTATAAGTTGTTCTCACGAGTCATCACAAATCGCCTGGCAAGAAGGTTCGACGAATTTCAGCCCCCAGAGCAGGCTGGGTTTCGGAGCGGCTATGGAACCATAGACCACATACACACAGTGCGGCAGATTATAGAAAAGACCACAGAATATAATCGGCCCCTGTGTTTAGCATTCGTGGATTATGAGAAGGCTTTCGACTCCATCGAGACTTGGTCTGTTCTGGACTCTCTGCGGCGATGCCAGGTAGACCATCGCTATGTCCAGGTGTTGAAATGCCTCTACGACTGTGCCACGATGAATGTTCGAATACAGAATCAGCAGTCTAACCCTATCCAATTGCGTAGGGGAGTGAGAGAGGGGGATGTCATTTCCCCGAAACTGTTTACCAACGCATTGGAAGATATGTTTAAGACGCTGGATTGGAAAAAGATGGGCATAAACATTAATGGCCAGTACATCTCACACTTGCGGTTCGCAGATGACATCGTTCTCATGGCGGAATCGTTGCAAGATCTGCAGCAGATGCTGAATGGCTTAGCAGATTCTTCGCGACGAATTGGACTCCGGATGAACATGGATAAAACCAAAGTGATGTTCAATTGTTACATTAGCCCGGGTCCGATCGTCGTGAAGGGCTGCCCGCTTGAAGCTGTTGATGAATATTTATACCTTGGGCAGACGCTGCAGATGGGTAAACACAGCTTGGAGAGGGAAATCAAGAGAAGGATCCAACTGGGCTGGGCGGCGTTCGGCAAACTGCGTGGAATCTTTTCATCGCACATCCCACAGTGCCTGAAAACGAAAGTTTTTAACCAGTGCGTCCTACCGGTAATGACTTACGGAGCCGAAACGTGGACACTCACAGTACGGTTGGTCCGTCAGCTCAAAGTCGCTCAGCGAGCCATGGAAAGAGTCATGCTCGGAGTTTCTCTGAAGGATAAAATCCGGAATGAGATTATTCGACAGAGAACTAAAGTCATCGACATAGCTCAAAGAGTCAGCAAGCTGAAGTGGCAGTGGGCTGGCCATATATGCCGTAGGACTGACGATCGCTGGAGCAGACGGGTTCTCGAGTGGAGACCGCGCAGCGGAAGACGTAACGTGGGACGCCCCTTGGCTAGATGGTGCGATGACCTCCGCACGGTGGCCGGCAAGAAGTGGATGAGGAGAGCCGCAGACCGGGCTCAGTGGTGTGGATTGGGAGAGGCCTATGTCCAGCAGTGGACGACTGTGGGCTGTTGA
Protein
MAIRRQDTSASPSERSALSKQITKLVRRDLRRSTTRRIERAIEQNRGSKVFNQQLKRSRLSKLKTSDGNVIMSQTGILAEIEKYYGQLYESCTTRSVQNSEQNDCRAPLTRHFTDELPDVSVDEIRLALRQLKNGKAPGDDGITTELLKAGGTPLLVELQKLFSHVIHRGRTPKAWNNSIVILFFKKGDKTLLKNYRPISLLNHVYKLFSRVITNRLARRFDEFQPPEQAGFRSGYGTIDHIHTVRQIIEKTTEYNRPLCLAFVDYEKAFDSIETWSVLDSLRRCQVDHRYVQVLKCLYDCATMNVRIQNQQSNPIQLRRGVREGDVISPKLFTNALEDMFKTLDWKKMGININGQYISHLRFADDIVLMAESLQDLQQMLNGLADSSRRIGLRMNMDKTKVMFNCYISPGPIVVKGCPLEAVDEYLYLGQTLQMGKHSLEREIKRRIQLGWAAFGKLRGIFSSHIPQCLKTKVFNQCVLPVMTYGAETWTLTVRLVRQLKVAQRAMERVMLGVSLKDKIRNEIIRQRTKVIDIAQRVSKLKWQWAGHICRRTDDRWSRRVLEWRPRSGRRNVGRPLARWCDDLRTVAGKKWMRRAADRAQWCGLGEAYVQQWTTVGC

Summary

EMBL
FJ265550    ADI61818.1    FJ265542    ADI61810.1    RSAL01002130    RVE40575.1    + More
FJ265551    ADI61819.1    FJ265549    ADI61817.1    FJ265545    ADI61813.1    FJ265544    ADI61812.1    FJ265543    ADI61811.1    RSAL01002362    RVE40503.1    EF113398    EF113401    ABO45231.1    EF113402    ABO45239.1    KZ150072    PZC74016.1    MRZV01002136    PIK34564.1    KZ149985    PZC75698.1    MRZV01000899    PIK42833.1    AAGJ04050748    AAGJ04144474    FJ265562    ADI61830.1    KZ150317    PZC71439.1    KZ150108    PZC73382.1    KZ150485    PZC70710.1    GFAC01005640    JAT93548.1    FJ265561    ADI61829.1    KZ149907    PZC78256.1    JARK01001677    EYB83168.1    EYB83167.1    JARK01001351    EYC23395.1    JARK01001340    EYC31295.1    FJ265564    ADI61832.1    JARK01001434    EYC02684.1    GBGD01000453    JAC88436.1    GBBI01004877    JAC13835.1    FJ265563    ADI61831.1    ODYU01004088    SOQ43598.1    JARK01001438    EYC02111.1    JARK01000173    EYC41342.1    JARK01001362    EYC18843.1    EYC18844.1    JARK01000388    EYC37469.1    JARK01000347    EYC38051.1    GBBI01004876    JAC13836.1    JARK01001370    EYC16150.1    ODYU01004982    SOQ45402.1    GDKW01001596    JAI54999.1    JARK01001621    EYB86109.1    JARK01001736    JARK01001462    JARK01001379    JARK01001338    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    JARK01000460    EYC36749.1    JARK01001655    EYB84321.1    JARK01001626    EYB85833.1    EYC30828.1    CAVP010058791    CDL95187.1    JARK01001389    EYC11015.1    JARK01001568    EYB89432.1    EYC16376.1    JARK01001639    EYB85201.1    JARK01001500    JARK01001343    EYB95040.1    EYC28825.1    JARK01001513    EYB93986.1    JARK01001353    EYC22263.1    JARK01001344    EYC28218.1    JARK01001349    EYC24735.1    JARK01001346    EYC26784.1    JARK01001517    EYB93530.1    EYC16151.1    JARK01001354    EYC21942.1    EYC02012.1    EYC21941.1    JARK01001361    EYC19034.1    EYB98997.1    JARK01001378    EYC13977.1    ODYU01008249    SOQ51673.1    JARK01001423    EYC04578.1    JARK01001406    EYC07496.1    JARK01001630    EYB85641.1    EYC28635.1    JARK01001341    EYC29807.1    JARK01000204    EYC40631.1    JARK01000077    EYC43894.1    JARK01001380    EYC13322.1    JARK01001711    EYB81734.1    JARK01000732    EYC35149.1    JARK01001543    EYB91354.1    JARK01001502    EYB94855.1    EYB91355.1    JARK01000248    EYC39628.1    JARK01001470    EYB98082.1    EYC40602.1    JARK01000249    EYC39611.1    JARK01000256    EYC39462.1    EYC31302.1    EYB98081.1    EYC40601.1    JARK01001365    EYC18010.1    EYC18009.1    JARK01001464    EYB98786.1    JARK01001401    EYC08686.1    JARK01001581    EYB88505.1    EYC33297.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF01826   TIL
PF03372   Exo_endo_phos
PF10323   7TM_GPCR_Srv
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR036084   Ser_inhib-like_sf       
IPR002919   TIL_dom       
IPR019426   7TM_GPCR_serpentine_rcpt_Srv       
SUPFAM
SSF56219   SSF56219        + More
SSF57567   SSF57567       
Gene 3D
PDB
6AR3     E-value=0.00904914,     Score=94

Ontologies

Topology

Length:
618
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02281
Exp number, first 60 AAs:
1e-05
Total prob of N-in:
0.00315
outside
1  -  618
 
 

Population Genetic Test Statistics

Pi
304.013666
Theta
191.227102
Tajima's D
1.918026
CLR
0.014301
CSRT
0.868006599670016
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号